ID: 1049541396

View in Genome Browser
Species Human (GRCh38)
Location 8:143210761-143210783
Sequence GGGGCTTGAGGGAGGCTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049541384_1049541396 12 Left 1049541384 8:143210726-143210748 CCCTGGAGTGTCTGAGAGGTCAT No data
Right 1049541396 8:143210761-143210783 GGGGCTTGAGGGAGGCTGCGTGG No data
1049541385_1049541396 11 Left 1049541385 8:143210727-143210749 CCTGGAGTGTCTGAGAGGTCATG No data
Right 1049541396 8:143210761-143210783 GGGGCTTGAGGGAGGCTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049541396 Original CRISPR GGGGCTTGAGGGAGGCTGCG TGG Intergenic
No off target data available for this crispr