ID: 1049544837

View in Genome Browser
Species Human (GRCh38)
Location 8:143225770-143225792
Sequence GCACCCTGCCCAGCACCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049544837_1049544847 22 Left 1049544837 8:143225770-143225792 CCTTGGGGTGCTGGGCAGGGTGC No data
Right 1049544847 8:143225815-143225837 GGGCGCCCAGGTCCGGGATCTGG No data
1049544837_1049544843 10 Left 1049544837 8:143225770-143225792 CCTTGGGGTGCTGGGCAGGGTGC No data
Right 1049544843 8:143225803-143225825 ACCAAGGTGAGTGGGCGCCCAGG No data
1049544837_1049544846 16 Left 1049544837 8:143225770-143225792 CCTTGGGGTGCTGGGCAGGGTGC No data
Right 1049544846 8:143225809-143225831 GTGAGTGGGCGCCCAGGTCCGGG No data
1049544837_1049544842 2 Left 1049544837 8:143225770-143225792 CCTTGGGGTGCTGGGCAGGGTGC No data
Right 1049544842 8:143225795-143225817 CATGCTGGACCAAGGTGAGTGGG No data
1049544837_1049544848 23 Left 1049544837 8:143225770-143225792 CCTTGGGGTGCTGGGCAGGGTGC No data
Right 1049544848 8:143225816-143225838 GGCGCCCAGGTCCGGGATCTGGG No data
1049544837_1049544841 1 Left 1049544837 8:143225770-143225792 CCTTGGGGTGCTGGGCAGGGTGC No data
Right 1049544841 8:143225794-143225816 CCATGCTGGACCAAGGTGAGTGG No data
1049544837_1049544839 -6 Left 1049544837 8:143225770-143225792 CCTTGGGGTGCTGGGCAGGGTGC No data
Right 1049544839 8:143225787-143225809 GGGTGCTCCATGCTGGACCAAGG No data
1049544837_1049544845 15 Left 1049544837 8:143225770-143225792 CCTTGGGGTGCTGGGCAGGGTGC No data
Right 1049544845 8:143225808-143225830 GGTGAGTGGGCGCCCAGGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049544837 Original CRISPR GCACCCTGCCCAGCACCCCA AGG (reversed) Intergenic
No off target data available for this crispr