ID: 1049547524

View in Genome Browser
Species Human (GRCh38)
Location 8:143240453-143240475
Sequence GCTGGCACAGGCAACAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049547524_1049547537 23 Left 1049547524 8:143240453-143240475 CCACAGCTGTTGCCTGTGCCAGC No data
Right 1049547537 8:143240499-143240521 GCACAGGGCACCAGGGCGATGGG No data
1049547524_1049547530 1 Left 1049547524 8:143240453-143240475 CCACAGCTGTTGCCTGTGCCAGC No data
Right 1049547530 8:143240477-143240499 GCTGCGGAGAAGGATGCCACAGG No data
1049547524_1049547534 16 Left 1049547524 8:143240453-143240475 CCACAGCTGTTGCCTGTGCCAGC No data
Right 1049547534 8:143240492-143240514 GCCACAGGCACAGGGCACCAGGG No data
1049547524_1049547531 7 Left 1049547524 8:143240453-143240475 CCACAGCTGTTGCCTGTGCCAGC No data
Right 1049547531 8:143240483-143240505 GAGAAGGATGCCACAGGCACAGG No data
1049547524_1049547527 -9 Left 1049547524 8:143240453-143240475 CCACAGCTGTTGCCTGTGCCAGC No data
Right 1049547527 8:143240467-143240489 TGTGCCAGCCGCTGCGGAGAAGG No data
1049547524_1049547533 15 Left 1049547524 8:143240453-143240475 CCACAGCTGTTGCCTGTGCCAGC No data
Right 1049547533 8:143240491-143240513 TGCCACAGGCACAGGGCACCAGG No data
1049547524_1049547532 8 Left 1049547524 8:143240453-143240475 CCACAGCTGTTGCCTGTGCCAGC No data
Right 1049547532 8:143240484-143240506 AGAAGGATGCCACAGGCACAGGG No data
1049547524_1049547536 22 Left 1049547524 8:143240453-143240475 CCACAGCTGTTGCCTGTGCCAGC No data
Right 1049547536 8:143240498-143240520 GGCACAGGGCACCAGGGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049547524 Original CRISPR GCTGGCACAGGCAACAGCTG TGG (reversed) Intergenic
No off target data available for this crispr