ID: 1049547526

View in Genome Browser
Species Human (GRCh38)
Location 8:143240465-143240487
Sequence TTCTCCGCAGCGGCTGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049547526_1049547540 21 Left 1049547526 8:143240465-143240487 CCTGTGCCAGCCGCTGCGGAGAA No data
Right 1049547540 8:143240509-143240531 CCAGGGCGATGGGCTCTCCAGGG No data
1049547526_1049547531 -5 Left 1049547526 8:143240465-143240487 CCTGTGCCAGCCGCTGCGGAGAA No data
Right 1049547531 8:143240483-143240505 GAGAAGGATGCCACAGGCACAGG No data
1049547526_1049547536 10 Left 1049547526 8:143240465-143240487 CCTGTGCCAGCCGCTGCGGAGAA No data
Right 1049547536 8:143240498-143240520 GGCACAGGGCACCAGGGCGATGG No data
1049547526_1049547538 20 Left 1049547526 8:143240465-143240487 CCTGTGCCAGCCGCTGCGGAGAA No data
Right 1049547538 8:143240508-143240530 ACCAGGGCGATGGGCTCTCCAGG No data
1049547526_1049547541 22 Left 1049547526 8:143240465-143240487 CCTGTGCCAGCCGCTGCGGAGAA No data
Right 1049547541 8:143240510-143240532 CAGGGCGATGGGCTCTCCAGGGG No data
1049547526_1049547537 11 Left 1049547526 8:143240465-143240487 CCTGTGCCAGCCGCTGCGGAGAA No data
Right 1049547537 8:143240499-143240521 GCACAGGGCACCAGGGCGATGGG No data
1049547526_1049547533 3 Left 1049547526 8:143240465-143240487 CCTGTGCCAGCCGCTGCGGAGAA No data
Right 1049547533 8:143240491-143240513 TGCCACAGGCACAGGGCACCAGG No data
1049547526_1049547534 4 Left 1049547526 8:143240465-143240487 CCTGTGCCAGCCGCTGCGGAGAA No data
Right 1049547534 8:143240492-143240514 GCCACAGGCACAGGGCACCAGGG No data
1049547526_1049547532 -4 Left 1049547526 8:143240465-143240487 CCTGTGCCAGCCGCTGCGGAGAA No data
Right 1049547532 8:143240484-143240506 AGAAGGATGCCACAGGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049547526 Original CRISPR TTCTCCGCAGCGGCTGGCAC AGG (reversed) Intergenic
No off target data available for this crispr