ID: 1049547529

View in Genome Browser
Species Human (GRCh38)
Location 8:143240475-143240497
Sequence TGTGGCATCCTTCTCCGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049547529_1049547534 -6 Left 1049547529 8:143240475-143240497 CCGCTGCGGAGAAGGATGCCACA No data
Right 1049547534 8:143240492-143240514 GCCACAGGCACAGGGCACCAGGG No data
1049547529_1049547542 24 Left 1049547529 8:143240475-143240497 CCGCTGCGGAGAAGGATGCCACA No data
Right 1049547542 8:143240522-143240544 CTCTCCAGGGGCAGTGTCAGTGG No data
1049547529_1049547536 0 Left 1049547529 8:143240475-143240497 CCGCTGCGGAGAAGGATGCCACA No data
Right 1049547536 8:143240498-143240520 GGCACAGGGCACCAGGGCGATGG No data
1049547529_1049547541 12 Left 1049547529 8:143240475-143240497 CCGCTGCGGAGAAGGATGCCACA No data
Right 1049547541 8:143240510-143240532 CAGGGCGATGGGCTCTCCAGGGG No data
1049547529_1049547540 11 Left 1049547529 8:143240475-143240497 CCGCTGCGGAGAAGGATGCCACA No data
Right 1049547540 8:143240509-143240531 CCAGGGCGATGGGCTCTCCAGGG No data
1049547529_1049547533 -7 Left 1049547529 8:143240475-143240497 CCGCTGCGGAGAAGGATGCCACA No data
Right 1049547533 8:143240491-143240513 TGCCACAGGCACAGGGCACCAGG No data
1049547529_1049547538 10 Left 1049547529 8:143240475-143240497 CCGCTGCGGAGAAGGATGCCACA No data
Right 1049547538 8:143240508-143240530 ACCAGGGCGATGGGCTCTCCAGG No data
1049547529_1049547537 1 Left 1049547529 8:143240475-143240497 CCGCTGCGGAGAAGGATGCCACA No data
Right 1049547537 8:143240499-143240521 GCACAGGGCACCAGGGCGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049547529 Original CRISPR TGTGGCATCCTTCTCCGCAG CGG (reversed) Intergenic
No off target data available for this crispr