ID: 1049547531

View in Genome Browser
Species Human (GRCh38)
Location 8:143240483-143240505
Sequence GAGAAGGATGCCACAGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049547524_1049547531 7 Left 1049547524 8:143240453-143240475 CCACAGCTGTTGCCTGTGCCAGC No data
Right 1049547531 8:143240483-143240505 GAGAAGGATGCCACAGGCACAGG No data
1049547523_1049547531 22 Left 1049547523 8:143240438-143240460 CCGGGAGGATCTCAGCCACAGCT No data
Right 1049547531 8:143240483-143240505 GAGAAGGATGCCACAGGCACAGG No data
1049547522_1049547531 30 Left 1049547522 8:143240430-143240452 CCAGGATGCCGGGAGGATCTCAG No data
Right 1049547531 8:143240483-143240505 GAGAAGGATGCCACAGGCACAGG No data
1049547526_1049547531 -5 Left 1049547526 8:143240465-143240487 CCTGTGCCAGCCGCTGCGGAGAA No data
Right 1049547531 8:143240483-143240505 GAGAAGGATGCCACAGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049547531 Original CRISPR GAGAAGGATGCCACAGGCAC AGG Intergenic
No off target data available for this crispr