ID: 1049547535

View in Genome Browser
Species Human (GRCh38)
Location 8:143240493-143240515
Sequence GCCCTGGTGCCCTGTGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049547535_1049547540 -7 Left 1049547535 8:143240493-143240515 CCACAGGCACAGGGCACCAGGGC No data
Right 1049547540 8:143240509-143240531 CCAGGGCGATGGGCTCTCCAGGG No data
1049547535_1049547544 24 Left 1049547535 8:143240493-143240515 CCACAGGCACAGGGCACCAGGGC No data
Right 1049547544 8:143240540-143240562 AGTGGCTCAGTCACCCACTGAGG No data
1049547535_1049547545 28 Left 1049547535 8:143240493-143240515 CCACAGGCACAGGGCACCAGGGC No data
Right 1049547545 8:143240544-143240566 GCTCAGTCACCCACTGAGGCTGG No data
1049547535_1049547541 -6 Left 1049547535 8:143240493-143240515 CCACAGGCACAGGGCACCAGGGC No data
Right 1049547541 8:143240510-143240532 CAGGGCGATGGGCTCTCCAGGGG No data
1049547535_1049547538 -8 Left 1049547535 8:143240493-143240515 CCACAGGCACAGGGCACCAGGGC No data
Right 1049547538 8:143240508-143240530 ACCAGGGCGATGGGCTCTCCAGG No data
1049547535_1049547542 6 Left 1049547535 8:143240493-143240515 CCACAGGCACAGGGCACCAGGGC No data
Right 1049547542 8:143240522-143240544 CTCTCCAGGGGCAGTGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049547535 Original CRISPR GCCCTGGTGCCCTGTGCCTG TGG (reversed) Intergenic
No off target data available for this crispr