ID: 1049547537

View in Genome Browser
Species Human (GRCh38)
Location 8:143240499-143240521
Sequence GCACAGGGCACCAGGGCGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049547528_1049547537 5 Left 1049547528 8:143240471-143240493 CCAGCCGCTGCGGAGAAGGATGC No data
Right 1049547537 8:143240499-143240521 GCACAGGGCACCAGGGCGATGGG No data
1049547524_1049547537 23 Left 1049547524 8:143240453-143240475 CCACAGCTGTTGCCTGTGCCAGC No data
Right 1049547537 8:143240499-143240521 GCACAGGGCACCAGGGCGATGGG No data
1049547526_1049547537 11 Left 1049547526 8:143240465-143240487 CCTGTGCCAGCCGCTGCGGAGAA No data
Right 1049547537 8:143240499-143240521 GCACAGGGCACCAGGGCGATGGG No data
1049547529_1049547537 1 Left 1049547529 8:143240475-143240497 CCGCTGCGGAGAAGGATGCCACA No data
Right 1049547537 8:143240499-143240521 GCACAGGGCACCAGGGCGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049547537 Original CRISPR GCACAGGGCACCAGGGCGAT GGG Intergenic
No off target data available for this crispr