ID: 1049547539

View in Genome Browser
Species Human (GRCh38)
Location 8:143240509-143240531
Sequence CCCTGGAGAGCCCATCGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049547539_1049547547 21 Left 1049547539 8:143240509-143240531 CCAGGGCGATGGGCTCTCCAGGG No data
Right 1049547547 8:143240553-143240575 CCCACTGAGGCTGGTATCCCAGG No data
1049547539_1049547542 -10 Left 1049547539 8:143240509-143240531 CCAGGGCGATGGGCTCTCCAGGG No data
Right 1049547542 8:143240522-143240544 CTCTCCAGGGGCAGTGTCAGTGG No data
1049547539_1049547545 12 Left 1049547539 8:143240509-143240531 CCAGGGCGATGGGCTCTCCAGGG No data
Right 1049547545 8:143240544-143240566 GCTCAGTCACCCACTGAGGCTGG No data
1049547539_1049547544 8 Left 1049547539 8:143240509-143240531 CCAGGGCGATGGGCTCTCCAGGG No data
Right 1049547544 8:143240540-143240562 AGTGGCTCAGTCACCCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049547539 Original CRISPR CCCTGGAGAGCCCATCGCCC TGG (reversed) Intergenic
No off target data available for this crispr