ID: 1049547540

View in Genome Browser
Species Human (GRCh38)
Location 8:143240509-143240531
Sequence CCAGGGCGATGGGCTCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049547529_1049547540 11 Left 1049547529 8:143240475-143240497 CCGCTGCGGAGAAGGATGCCACA No data
Right 1049547540 8:143240509-143240531 CCAGGGCGATGGGCTCTCCAGGG No data
1049547526_1049547540 21 Left 1049547526 8:143240465-143240487 CCTGTGCCAGCCGCTGCGGAGAA No data
Right 1049547540 8:143240509-143240531 CCAGGGCGATGGGCTCTCCAGGG No data
1049547535_1049547540 -7 Left 1049547535 8:143240493-143240515 CCACAGGCACAGGGCACCAGGGC No data
Right 1049547540 8:143240509-143240531 CCAGGGCGATGGGCTCTCCAGGG No data
1049547528_1049547540 15 Left 1049547528 8:143240471-143240493 CCAGCCGCTGCGGAGAAGGATGC No data
Right 1049547540 8:143240509-143240531 CCAGGGCGATGGGCTCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049547540 Original CRISPR CCAGGGCGATGGGCTCTCCA GGG Intergenic
No off target data available for this crispr