ID: 1049547544

View in Genome Browser
Species Human (GRCh38)
Location 8:143240540-143240562
Sequence AGTGGCTCAGTCACCCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049547535_1049547544 24 Left 1049547535 8:143240493-143240515 CCACAGGCACAGGGCACCAGGGC No data
Right 1049547544 8:143240540-143240562 AGTGGCTCAGTCACCCACTGAGG No data
1049547543_1049547544 -9 Left 1049547543 8:143240526-143240548 CCAGGGGCAGTGTCAGTGGCTCA No data
Right 1049547544 8:143240540-143240562 AGTGGCTCAGTCACCCACTGAGG No data
1049547539_1049547544 8 Left 1049547539 8:143240509-143240531 CCAGGGCGATGGGCTCTCCAGGG No data
Right 1049547544 8:143240540-143240562 AGTGGCTCAGTCACCCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049547544 Original CRISPR AGTGGCTCAGTCACCCACTG AGG Intergenic
No off target data available for this crispr