ID: 1049547545

View in Genome Browser
Species Human (GRCh38)
Location 8:143240544-143240566
Sequence GCTCAGTCACCCACTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049547543_1049547545 -5 Left 1049547543 8:143240526-143240548 CCAGGGGCAGTGTCAGTGGCTCA No data
Right 1049547545 8:143240544-143240566 GCTCAGTCACCCACTGAGGCTGG No data
1049547535_1049547545 28 Left 1049547535 8:143240493-143240515 CCACAGGCACAGGGCACCAGGGC No data
Right 1049547545 8:143240544-143240566 GCTCAGTCACCCACTGAGGCTGG No data
1049547539_1049547545 12 Left 1049547539 8:143240509-143240531 CCAGGGCGATGGGCTCTCCAGGG No data
Right 1049547545 8:143240544-143240566 GCTCAGTCACCCACTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049547545 Original CRISPR GCTCAGTCACCCACTGAGGC TGG Intergenic
No off target data available for this crispr