ID: 1049549117

View in Genome Browser
Species Human (GRCh38)
Location 8:143248464-143248486
Sequence ACTCCACTCCACGGCGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049549117_1049549123 -4 Left 1049549117 8:143248464-143248486 CCCGCCCCGCCGTGGAGTGGAGT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1049549123 8:143248483-143248505 GAGTCTGCAGAGAGCCAGATAGG 0: 1
1: 0
2: 2
3: 41
4: 439
1049549117_1049549125 13 Left 1049549117 8:143248464-143248486 CCCGCCCCGCCGTGGAGTGGAGT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1049549125 8:143248500-143248522 GATAGGTTCCCGCCATGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049549117 Original CRISPR ACTCCACTCCACGGCGGGGC GGG (reversed) Intronic
901026172 1:6279809-6279831 CCTCCACTCCAGGAAGGGGCAGG + Intronic
901026526 1:6281319-6281341 CCTCCACCCCACGGCTGGGCGGG + Intronic
901303611 1:8217147-8217169 ACTGCACTCCCCGGCCGAGCTGG - Intergenic
905150131 1:35920698-35920720 ACTCCAGACCTGGGCGGGGCGGG - Exonic
907249142 1:53126402-53126424 ACTCCACTATAAGGCGGGGGTGG + Intronic
909204920 1:72743686-72743708 ACTCTACTCCAAGATGGGGCTGG + Intergenic
921290937 1:213656695-213656717 ACTCCACTTCACTGAGGGGCTGG + Intergenic
1069553302 10:69379895-69379917 GCTCCACTCCCAGGCGGGTCAGG - Exonic
1072626217 10:97113940-97113962 ACTACACTCCCAGGTGGGGCAGG + Intronic
1081794491 11:45810123-45810145 ACTACACTCCTTGGCGTGGCAGG - Intronic
1088763717 11:112956765-112956787 ACTCTAACCCATGGCGGGGCTGG - Intergenic
1093562153 12:20553693-20553715 ACTCCGCTCCACGTGGGGCCAGG + Intronic
1097155148 12:57006650-57006672 GCGCCCCCCCACGGCGGGGCCGG + Intergenic
1101927656 12:108985981-108986003 ACTCCACTCCTTGGCAAGGCTGG + Intronic
1104806542 12:131592757-131592779 AATCCAGTCCTCGGTGGGGCAGG - Intergenic
1115566465 14:34629635-34629657 CCTCCACTCCCACGCGGGGCGGG - Intronic
1116390412 14:44384339-44384361 TCTCCCCTCCATGCCGGGGCTGG - Intergenic
1121643449 14:95501626-95501648 ACTCCACTCAAAGGGAGGGCTGG + Intergenic
1122353091 14:101108770-101108792 ACCCCACCCCACTGCGGGCCAGG - Intergenic
1122986293 14:105213139-105213161 ACTCCACTGCACAGTGGGCCTGG - Intronic
1124995875 15:34722413-34722435 AGTCCACTCCACGGTGGAACTGG + Intergenic
1133209689 16:4256719-4256741 ACACCACACCACGGGGGGGCAGG + Intergenic
1137750082 16:50854785-50854807 ACTCCACTCCAGGCCTGGGTAGG + Intergenic
1137787665 16:51151663-51151685 CCTCCTCTCCACTGCGGGCCCGG + Intergenic
1138531648 16:57637720-57637742 GCTCTGCTCCACGGAGGGGCGGG + Intronic
1142670666 17:1486068-1486090 ACTACACTCCGCGGCGGGCCTGG + Intronic
1143582364 17:7834620-7834642 TCCCGACTCCAGGGCGGGGCGGG + Intergenic
1147156253 17:38545788-38545810 ACTCGACACCAAGGTGGGGCCGG + Intronic
1147966975 17:44199175-44199197 ACTCCTCTCCCCGGCCGGCCGGG - Intronic
1148052546 17:44776214-44776236 GCTCCACAAGACGGCGGGGCCGG - Intronic
1152705753 17:81842819-81842841 TCGTCACTCCACGGCGGGGATGG + Intergenic
1152831079 17:82497368-82497390 CCTCCACAGCGCGGCGGGGCGGG + Intergenic
1159369842 18:67516434-67516456 ACTGCTCTGCACGGCGGGCCAGG + Exonic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1160225476 18:77008229-77008251 ACTGCTCTCCAGGGCGGGGCCGG + Intronic
1160562748 18:79770100-79770122 CCTCCGGTCCACGTCGGGGCTGG - Intergenic
1167210405 19:48130646-48130668 GCTGCAGTCCACGGCGGGGGAGG + Intronic
925147616 2:1591620-1591642 ACTCAGCTCCACGCCGGGGATGG + Intergenic
926121338 2:10242739-10242761 ACTGGGCTCCACGGGGGGGCGGG + Intergenic
927782597 2:25951726-25951748 GGTCCACTCCAGGTCGGGGCTGG - Intronic
942947260 2:181684091-181684113 ACCCCACTCCTAGGCAGGGCGGG - Intergenic
1170461598 20:16581815-16581837 ACTCAACTCCAGTGTGGGGCTGG - Intergenic
1170770340 20:19327243-19327265 TCCTCACTCCATGGCGGGGCAGG + Intronic
1171444714 20:25195515-25195537 TCTCCAGTCCACAGCCGGGCTGG - Intergenic
1172270909 20:33655285-33655307 ACTGCACTGCAGGGCGAGGCAGG + Intergenic
1173782315 20:45766208-45766230 GCTCCATTCCAGGGCAGGGCAGG + Intronic
1175910886 20:62405047-62405069 GCTCCACTCCACGCCAGGCCTGG + Intronic
1176085275 20:63293003-63293025 ACCCCACTGCACAGCAGGGCAGG - Intergenic
1180919804 22:19515891-19515913 ACTCCACAACAGGGCCGGGCAGG - Intronic
1180955847 22:19740869-19740891 ACTGCAGTCCAGGGAGGGGCAGG - Intergenic
950095945 3:10330503-10330525 ACTCCACTCCGAGTTGGGGCTGG - Intronic
962346561 3:134623364-134623386 CCTCCACTTCACGGCAGGCCAGG + Intronic
965678375 3:171223997-171224019 TCTCCAGTCCACGCCTGGGCTGG - Intronic
975715889 4:77205525-77205547 ACTCCTCTCCGTGGCGGGGTAGG - Intronic
977231184 4:94452373-94452395 ACACCACACCACGGTGGTGCCGG - Intronic
983577154 4:169271444-169271466 CCTCCTCCCCCCGGCGGGGCTGG + Intergenic
987335366 5:16893944-16893966 ACTGCACTCCACTGCCTGGCTGG - Intronic
997226121 5:132210701-132210723 ACCCCAGTCCAGGGCAGGGCTGG - Intronic
1003220507 6:4156935-4156957 CTTCCACACCACGGCGCGGCAGG + Intergenic
1007374350 6:41446042-41446064 ACTCCAGTACAGGGCAGGGCTGG - Intergenic
1011994621 6:93569581-93569603 TCTCCACTCCCAGGTGGGGCTGG + Intergenic
1012470568 6:99568640-99568662 ACTCCGCTCCGCGGCGGCGACGG + Exonic
1012476469 6:99619184-99619206 GCTCCCCTCCACAGCGGGGTCGG - Intergenic
1018950338 6:168374746-168374768 ACTCCACTCCACGGCTGCCCAGG + Intergenic
1024827865 7:53414024-53414046 ACTCCACTCAACGCAGGGACTGG - Intergenic
1033645537 7:143300278-143300300 ACTCACCTCCACGGCAGGCCTGG - Exonic
1034499416 7:151440194-151440216 CCACCACTCCAGGGCAGGGCAGG - Intronic
1035301834 7:157902342-157902364 TCTCCAGGCCACCGCGGGGCTGG - Intronic
1035301850 7:157902410-157902432 TCTCCAGGCCACCGCGGGGCTGG - Intronic
1035301861 7:157902444-157902466 TCTCCAGGCCACCGCGGGGCTGG - Intronic
1035301888 7:157902546-157902568 TCTCCAGACCACCGCGGGGCTGG - Intronic
1037922056 8:22814451-22814473 CCTCCACTCCAAAGAGGGGCTGG - Intronic
1042565085 8:70102911-70102933 ACTCCACTCCAAGGCAGTACAGG + Intergenic
1044692659 8:94895405-94895427 ACCGCGCTCCACGGCGCGGCCGG + Intronic
1044786991 8:95805070-95805092 ACTCCTCTCCAGGTCAGGGCTGG - Intergenic
1046268796 8:111865903-111865925 ACTGCACTCCACGGGGTGACAGG + Intergenic
1047738771 8:127790196-127790218 ACTCCACTCCACCGGGTGACAGG - Intergenic
1049549117 8:143248464-143248486 ACTCCACTCCACGGCGGGGCGGG - Intronic
1049645264 8:143733297-143733319 ACCCCAGTCCACGGCGGCCCGGG + Intronic
1049843590 8:144789134-144789156 ACTCCCCACCATGGCGGGGTGGG + Intergenic
1054775534 9:69121230-69121252 ACGCCACTCAGCGGTGGGGCAGG - Intergenic
1055934463 9:81591974-81591996 ACACCACACCAGGGCAGGGCAGG + Intronic
1061537322 9:131258258-131258280 TGTCCACGCCAGGGCGGGGCTGG + Exonic
1061727616 9:132590105-132590127 TCCCCACTCCCAGGCGGGGCAGG + Exonic
1062066642 9:134531537-134531559 ACCCCACTCCGGGGAGGGGCTGG + Intergenic
1062491857 9:136808575-136808597 GCTCCACTGCACAGCGCGGCGGG - Intronic
1062556414 9:137115054-137115076 GCCCCACTCCAAGGCAGGGCCGG + Intronic
1197673260 X:129302186-129302208 ACTCCACTCCAGGTTGGGGAGGG - Intergenic
1198348634 X:135784518-135784540 ACCCCACTCCCCGGCGGCACCGG + Intergenic
1198352446 X:135819055-135819077 ACCCCACTCCCCGGCGGCACCGG + Intronic
1198354355 X:135836323-135836345 ACCCCACTCCCCGGCGGCACCGG + Intronic