ID: 1049552495

View in Genome Browser
Species Human (GRCh38)
Location 8:143267079-143267101
Sequence GCGGCCCCTCCGTGCACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049552495_1049552503 17 Left 1049552495 8:143267079-143267101 CCTGGAGTGCACGGAGGGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1049552503 8:143267119-143267141 CGCCGTCATCTCCCGAAGCCCGG No data
1049552495_1049552506 28 Left 1049552495 8:143267079-143267101 CCTGGAGTGCACGGAGGGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1049552506 8:143267130-143267152 CCCGAAGCCCGGCCCCGCGCTGG No data
1049552495_1049552501 -6 Left 1049552495 8:143267079-143267101 CCTGGAGTGCACGGAGGGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1049552501 8:143267096-143267118 GGCCGCGGGCAGCGTGGGGACGG No data
1049552495_1049552500 -10 Left 1049552495 8:143267079-143267101 CCTGGAGTGCACGGAGGGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1049552500 8:143267092-143267114 GAGGGGCCGCGGGCAGCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049552495 Original CRISPR GCGGCCCCTCCGTGCACTCC AGG (reversed) Intronic
900030348 1:366800-366822 TCCGCCTCTCCGTGCAGTCCCGG + Intergenic
900195188 1:1372277-1372299 CAGACCCCTCCGTGCACTCAGGG + Intergenic
900298518 1:1964980-1965002 GCCGCTCCACCGTGCGCTCCAGG + Exonic
900648925 1:3721689-3721711 GCAGCCCCTTCTTGCTCTCCTGG + Intronic
900973439 1:6004032-6004054 GGGGCTCCTCCCTGCTCTCCGGG - Intronic
901526012 1:9823845-9823867 GCGGCTCCTCCTTGGACCCCCGG - Exonic
902368282 1:15991005-15991027 CCTTCCCCTCCCTGCACTCCTGG - Intergenic
902517080 1:16995321-16995343 GCAGCTCCTTTGTGCACTCCTGG + Intronic
903330305 1:22593685-22593707 ACGCCCCCTCCCTGCACTCACGG - Exonic
904050184 1:27634208-27634230 GCAGCCCCTGCGGGCACTCGCGG + Intronic
904082906 1:27883057-27883079 GTGACCCCTCCGTGCCCTCTGGG - Intronic
904560574 1:31394706-31394728 GCGCCTCCTCCGTGCACCCAGGG + Intergenic
905254501 1:36671437-36671459 GCTGCCTCTCCTTGCACTCTAGG + Intergenic
906214333 1:44030383-44030405 CCGGCCCCTCCCGGCCCTCCGGG + Intronic
910232174 1:84997731-84997753 GCGGCCGCACCTGGCACTCCCGG + Intergenic
923008070 1:230067575-230067597 CCGGCCCCTCTGCGCACGCCGGG + Intronic
923346013 1:233053266-233053288 GCGGCATCTCAGAGCACTCCTGG - Intronic
1062906103 10:1180461-1180483 CTGGCCCCTTCGGGCACTCCTGG + Exonic
1063941116 10:11130403-11130425 GTTGCCCCTCCTTGCACCCCAGG + Intronic
1065046771 10:21752757-21752779 TGGGTCACTCCGTGCACTCCCGG - Intergenic
1065342888 10:24723389-24723411 GCGGCCCCTCCGCCCCCGCCGGG + Intronic
1072252315 10:93591305-93591327 CCAGCCCCTCCCTGCATTCCGGG + Intronic
1074384417 10:113005643-113005665 GTGGCCCCTCCTTGTACTTCGGG + Intronic
1075402748 10:122172796-122172818 GCTCACCCTCTGTGCACTCCTGG - Intronic
1075780703 10:125015519-125015541 GGGCTCCCTCCGTCCACTCCCGG + Intronic
1076576903 10:131475351-131475373 CCGGCCCCTTCCTGCACTCAGGG + Intergenic
1078987092 11:16607178-16607200 CCTGCCCTTCCGGGCACTCCAGG - Intronic
1079362017 11:19777320-19777342 GCGGCCCCTCCAGGCATCCCCGG - Intronic
1083274830 11:61591013-61591035 GAGCCCCCTCCCTCCACTCCAGG + Intergenic
1084112565 11:67023439-67023461 GCGGCCCCTCCGCGGAGCCCGGG + Intronic
1084204392 11:67583629-67583651 GCGGCGACTCCGGGGACTCCAGG + Exonic
1092767845 12:11869554-11869576 GCGGCCCCTCCGGTCCCCCCTGG + Exonic
1096021571 12:48329743-48329765 GCGGCGCCTCCGGGAGCTCCGGG - Exonic
1100869533 12:98895310-98895332 CCGCCCCCTCCGCGCACTCCGGG + Intronic
1102895071 12:116592330-116592352 ACCGCCCCTCCCTGCACCCCAGG - Intergenic
1103942055 12:124506540-124506562 ACGAACCCTCCCTGCACTCCAGG + Intronic
1106249616 13:27973529-27973551 GCGGCCCCTCCCTGCTGTTCAGG - Intergenic
1106543793 13:30713542-30713564 GCTGCCCCTCCCTGGAGTCCGGG - Intronic
1110219720 13:73059722-73059744 GCAGCCCCGCCCTGCACGCCTGG + Intronic
1111920334 13:94403150-94403172 GTGGCCACTCCCTGCTCTCCTGG + Exonic
1113480771 13:110619000-110619022 GCGGCCCTGCTGTGCCCTCCTGG + Intronic
1113568935 13:111339566-111339588 GCCGTCTCTCCATGCACTCCCGG + Intronic
1113856088 13:113446143-113446165 GCGGGCCCTGCGTGCTCTCTGGG - Intronic
1113944199 13:114034451-114034473 GCGGCCCCCGTGTGCTCTCCCGG + Intronic
1114049631 14:18912782-18912804 GCGGGCCATCCCTGCAGTCCTGG + Intergenic
1114112930 14:19489149-19489171 GCGGGCCATCCCTGCAGTCCTGG - Intergenic
1115873574 14:37835104-37835126 GCGGCCAGTCTTTGCACTCCTGG + Intronic
1117951027 14:61082784-61082806 GCTGCCTCTGCCTGCACTCCAGG + Intronic
1119418749 14:74493672-74493694 GCGGGGCCTCCGTGAAGTCCCGG + Intronic
1121011818 14:90524329-90524351 GCCGCCCCACCATGCACTCCTGG + Intergenic
1122152157 14:99731156-99731178 CCGGCCCCTCCTGGCAGTCCTGG + Intergenic
1122232791 14:100315306-100315328 ACAGCCCCTCCTTGCTCTCCTGG + Intergenic
1125775377 15:42208064-42208086 GCGGCCCCTCGGCTCACCCCAGG + Exonic
1128146027 15:65333020-65333042 CCGGCCTCTGCGTGCCCTCCGGG - Intronic
1128515495 15:68339438-68339460 GCAGCCCCTGGGTGCCCTCCCGG + Intronic
1132553884 16:564400-564422 CCAGCCCCTCCGTCCACCCCAGG - Intronic
1136519570 16:30786971-30786993 GCGGCCGTCCCGGGCACTCCAGG + Intronic
1141590452 16:85065319-85065341 CCGGCCACTCCTTGCTCTCCAGG + Intronic
1142124601 16:88403895-88403917 GCTGCCCCTCCTTGCCCACCAGG - Intergenic
1142347013 16:89560656-89560678 GCGGCCCCGCAATGCACTCTGGG - Exonic
1142596257 17:1031477-1031499 CCGCCCCCTCCGTGGAGTCCCGG - Intronic
1143374220 17:6457886-6457908 GCTGCCCCTCCCTGCACCCCAGG + Intronic
1143610400 17:8014693-8014715 CCAGCTCCTCCGTGCGCTCCCGG - Exonic
1148111333 17:45146127-45146149 ACTGCCCCTCAGAGCACTCCTGG - Intergenic
1152209174 17:78994045-78994067 CCCGCCCCTCCCTGCTCTCCAGG + Intronic
1152388816 17:79991202-79991224 GCGGTCCCTGCGTCCACGCCGGG + Intronic
1152832175 17:82504131-82504153 GCTGCGCCTGCCTGCACTCCAGG + Intergenic
1152949410 17:83219757-83219779 TCCGCCTCTCCGTGCAGTCCCGG - Intergenic
1157545214 18:48541423-48541445 GCGGCCCCTCCCTGCGCTCTGGG - Intronic
1160775191 19:852283-852305 TCTGCCCCTCCGTGCCCGCCCGG - Exonic
1161480021 19:4505797-4505819 GCGTCCCCTCGGTGCCCACCAGG + Intronic
1161959510 19:7516115-7516137 GCGGCCCCGCCAGGCGCTCCCGG - Exonic
1163464712 19:17460611-17460633 GCTGCTCCTCCGTGGAGTCCTGG + Exonic
1164977189 19:32581766-32581788 GCGGCCCCTCCCTGTCATCCCGG - Intronic
1165246566 19:34501405-34501427 GAGGTCCCTCCGTGCTCCCCGGG + Exonic
1165648989 19:37469315-37469337 GCGGCCCCTTTGTGTCCTCCGGG + Exonic
1166305079 19:41932810-41932832 GCTGCCTCCCCGTGCTCTCCTGG - Intergenic
1167307901 19:48719646-48719668 GCGCCCCCCCCGTCCACCCCAGG + Intronic
1168257636 19:55175339-55175361 GCGGATTCTCTGTGCACTCCAGG - Exonic
1168584779 19:57583616-57583638 GCGGCCCCCACGTGGCCTCCCGG + Intronic
925578878 2:5389702-5389724 GCCTCCCCTCCCTGCACCCCTGG + Intergenic
929127705 2:38536160-38536182 GCGACCGCTCCGCGCACTCCCGG - Intergenic
932245145 2:70190649-70190671 GCGGCCGCTCCGTTGACTGCAGG - Intronic
933009893 2:77047481-77047503 TACGCCCCTCCGTGCACTTCCGG + Intronic
936038164 2:109129053-109129075 GCGGCACCTCCATGCGCCCCTGG - Intergenic
936520735 2:113210544-113210566 GCTGCCCCTCCCTGCACATCTGG - Intergenic
937941978 2:127293462-127293484 GCTGCCGCTCCGCACACTCCTGG + Intronic
937973227 2:127565804-127565826 GTGGGCCCTCCGTGCAAACCTGG + Intronic
938288599 2:130137771-130137793 GCGGGCCATCCCTGCAGTCCTGG - Intergenic
938426990 2:131201116-131201138 GCGGGCCATCCCTGCAGTCCTGG + Intronic
938467934 2:131535161-131535183 GCGGGCCATCCCTGCAGTCCTGG + Intergenic
942453571 2:176123103-176123125 CCGGCCGCTACGTGCGCTCCTGG + Exonic
943474169 2:188333936-188333958 GCAGGGACTCCGTGCACTCCAGG + Intronic
947523245 2:230864307-230864329 GCGGCTCCAGCGTGCACCCCAGG + Intergenic
947724283 2:232387690-232387712 GTGGCCCCGCCGAGCCCTCCTGG - Intergenic
948267221 2:236643711-236643733 GCAGCCCACCTGTGCACTCCAGG + Intergenic
1171328389 20:24316560-24316582 GTGGCCCCACCGTGGACTGCAGG + Intergenic
1174595417 20:51679587-51679609 GCAGCCCCTCCTTGCTCTCAAGG + Intronic
1179821318 21:43939034-43939056 GCGGCCCCTGCGTGCTCTGTGGG - Intronic
1179961068 21:44767177-44767199 GCGGCCCCGCGGTCCCCTCCAGG + Intergenic
1180468111 22:15635157-15635179 GCGGGCCATCCCTGCAGTCCTGG + Intergenic
1181770340 22:25120485-25120507 TCTGCCCCTCCATTCACTCCAGG - Intronic
1182122522 22:27797152-27797174 CCGGGCCATCCGGGCACTCCGGG - Exonic
1184984365 22:48119396-48119418 GCCCCTCCTCCCTGCACTCCAGG + Intergenic
1185219857 22:49623867-49623889 GCGCCCCTTCCGAGGACTCCTGG + Intronic
950105866 3:10388032-10388054 GAGGCCCCTCCTTCCCCTCCGGG - Intronic
950565043 3:13764347-13764369 CCCGCCCTTCCTTGCACTCCAGG + Intergenic
958165863 3:89877302-89877324 GGAGCCCCTCTATGCACTCCAGG + Intergenic
959902317 3:111674655-111674677 GCAGCCCCTCCCCGCACTGCCGG - Intronic
961081925 3:124034260-124034282 GCCGCCCCTCTGTGCACATCAGG - Intergenic
963906680 3:150779019-150779041 GCGGCTCCTCCGCGCAGGCCTGG + Intergenic
964438071 3:156674807-156674829 TCAGCCCCTCAGTGCCCTCCCGG - Intronic
968092776 3:195909003-195909025 CCGGCCCCTCCCTGCGCTCGCGG + Intronic
968905658 4:3449515-3449537 GCGGCCCCGCCTTCCCCTCCAGG + Intergenic
969474907 4:7416337-7416359 GCTCCCCCTCCTTGCCCTCCAGG + Intronic
969540857 4:7787992-7788014 GCGGCCCCTCCCTCCCCTCCGGG + Intronic
974068342 4:57101418-57101440 GAGGCCCCTCCCTGGATTCCCGG + Intronic
985073453 4:186191046-186191068 CCCGCCCCTGCGTGCTCTCCGGG + Intergenic
985073650 4:186191790-186191812 GCGGCCGCGGGGTGCACTCCGGG - Exonic
987193282 5:15500479-15500501 GCGTCCCCTCCTGGCACCCCCGG - Exonic
991130896 5:63121294-63121316 GCCCCCACTCCCTGCACTCCAGG - Intergenic
998658133 5:144205244-144205266 GCGGCGTCCCCGTGCAGTCCTGG + Intronic
999098014 5:148998634-148998656 GCAGCCCCACTGTGCAGTCCTGG + Intronic
1002172875 5:177385177-177385199 GCAGCTCCTCCTTGCTCTCCAGG + Intronic
1002190036 5:177473291-177473313 GCAGCCCCTCCCGGCCCTCCCGG + Intronic
1002743641 5:181453572-181453594 TCCGCCTCTCCGTGCAGTCCCGG - Intergenic
1006136032 6:31897126-31897148 GCGGCCCCTCCGGGCAGCCGAGG - Intronic
1006168395 6:32079288-32079310 GCGGCTCCTCGGGGGACTCCGGG + Intronic
1006304672 6:33211829-33211851 GCGCCCCCTCCAGGCCCTCCTGG - Exonic
1006470205 6:34224336-34224358 GCGGCCGCTGCCCGCACTCCCGG + Intergenic
1007492685 6:42236267-42236289 GCGGCCCCTCCGTGGGAGCCAGG + Exonic
1011633979 6:89353094-89353116 GCGCCCCCTCCGAGCTCTCGAGG - Intergenic
1015935567 6:138403947-138403969 GCGGCCCCTGCCCGCACTCCTGG - Intronic
1017239001 6:152146856-152146878 GGAGCTCCTCCGTTCACTCCAGG + Intronic
1017978174 6:159375830-159375852 ACTGCCCCTCCCTGCGCTCCGGG - Intergenic
1018013506 6:159692994-159693016 GCCGCCGCGCCGGGCACTCCCGG + Intronic
1019248499 6:170726801-170726823 TCCGCCTCTCCGTGCAGTCCCGG - Intergenic
1019396838 7:824890-824912 GCTGCTCCTCCGAGCACCCCTGG - Intronic
1019417647 7:934711-934733 GTGGCCCCTCCCTGCACGCCAGG + Intronic
1019434436 7:1014903-1014925 GCGGGCCCTCCCTGCCCTGCAGG + Intronic
1020016167 7:4833421-4833443 GTGTCCCCTCCGTGCAGTCATGG - Intronic
1022552847 7:31258094-31258116 GCGGCCCCACCTTCCATTCCAGG - Intergenic
1023842245 7:44104242-44104264 GCAGCCCCTCCGTCCACTCTCGG + Intergenic
1023967338 7:44969812-44969834 GCGGCCCCACCGTGGCATCCTGG - Exonic
1024619607 7:51146375-51146397 GCAGCCCCTCCCTGCAGTCATGG - Intronic
1024639349 7:51316824-51316846 CCAGCCCCTCCCTGCGCTCCCGG - Intergenic
1028582378 7:92421516-92421538 GCGGCCCCTCCTTTCAGTCCTGG - Intergenic
1034522469 7:151631857-151631879 GCGTCCCCTCCGCGGACGCCCGG + Intronic
1035265086 7:157685807-157685829 GCTTCCCCTCCGGGGACTCCTGG - Intronic
1035470337 7:159105270-159105292 CGGACCCCTCCATGCACTCCTGG + Intronic
1044999856 8:97869553-97869575 GCGCCCCCACGGGGCACTCCGGG - Intronic
1045962355 8:107982999-107983021 GTGGCCCCTCTCTGCACCCCAGG - Intronic
1048819179 8:138364097-138364119 GGGGCCCCACCTTGCACACCAGG + Intronic
1049160494 8:141094805-141094827 GGGGCCGTTCCGTGCACTGCAGG + Intergenic
1049409430 8:142465861-142465883 CCTGCCCCTCTGTGCTCTCCGGG - Intronic
1049552495 8:143267079-143267101 GCGGCCCCTCCGTGCACTCCAGG - Intronic
1049618956 8:143589257-143589279 GCGGCCCCGCCGGGCACCCTCGG + Exonic
1052862900 9:33447658-33447680 GCAGCCCCGCCCTGCAGTCCCGG + Intergenic
1057209586 9:93192549-93192571 CTGGCCCATCCCTGCACTCCTGG - Intronic
1057211060 9:93201378-93201400 GAGGCCCCTGCGTGCCTTCCTGG + Intronic
1061268618 9:129523283-129523305 CAGGCCCCTCCCTGCACTCCAGG - Intergenic
1062218746 9:135403212-135403234 CCGGCCCCTCCTTCCCCTCCCGG + Intergenic
1062579285 9:137222349-137222371 GCCGCCCCTCGGTCCGCTCCCGG + Intergenic
1062634409 9:137482684-137482706 GCAGCCCGTCCGTGCCCTCCTGG - Intronic
1203792567 EBV:159681-159703 GGGGCACCTCCGGGCTCTCCCGG + Intergenic
1203609459 Un_KI270748v1:84065-84087 TCCGCCTCTCCGTGCAGTCCCGG - Intergenic
1188112754 X:26211547-26211569 GCTACCCCTCCCTGCACTGCAGG + Intergenic
1190713837 X:53088019-53088041 GCGGCCCCACATTGCACTTCTGG + Exonic
1201077052 Y:10196492-10196514 GCCGCCCCTCTGTGGGCTCCCGG + Intergenic