ID: 1049552502

View in Genome Browser
Species Human (GRCh38)
Location 8:143267098-143267120
Sequence CGCCGTCCCCACGCTGCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 155}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049552502_1049552511 18 Left 1049552502 8:143267098-143267120 CCGCGGGCAGCGTGGGGACGGCG 0: 1
1: 0
2: 3
3: 23
4: 155
Right 1049552511 8:143267139-143267161 CGGCCCCGCGCTGGCTCCCCGGG No data
1049552502_1049552503 -2 Left 1049552502 8:143267098-143267120 CCGCGGGCAGCGTGGGGACGGCG 0: 1
1: 0
2: 3
3: 23
4: 155
Right 1049552503 8:143267119-143267141 CGCCGTCATCTCCCGAAGCCCGG No data
1049552502_1049552517 28 Left 1049552502 8:143267098-143267120 CCGCGGGCAGCGTGGGGACGGCG 0: 1
1: 0
2: 3
3: 23
4: 155
Right 1049552517 8:143267149-143267171 CTGGCTCCCCGGGCGGTGCAGGG No data
1049552502_1049552506 9 Left 1049552502 8:143267098-143267120 CCGCGGGCAGCGTGGGGACGGCG 0: 1
1: 0
2: 3
3: 23
4: 155
Right 1049552506 8:143267130-143267152 CCCGAAGCCCGGCCCCGCGCTGG No data
1049552502_1049552510 17 Left 1049552502 8:143267098-143267120 CCGCGGGCAGCGTGGGGACGGCG 0: 1
1: 0
2: 3
3: 23
4: 155
Right 1049552510 8:143267138-143267160 CCGGCCCCGCGCTGGCTCCCCGG No data
1049552502_1049552513 21 Left 1049552502 8:143267098-143267120 CCGCGGGCAGCGTGGGGACGGCG 0: 1
1: 0
2: 3
3: 23
4: 155
Right 1049552513 8:143267142-143267164 CCCCGCGCTGGCTCCCCGGGCGG No data
1049552502_1049552516 27 Left 1049552502 8:143267098-143267120 CCGCGGGCAGCGTGGGGACGGCG 0: 1
1: 0
2: 3
3: 23
4: 155
Right 1049552516 8:143267148-143267170 GCTGGCTCCCCGGGCGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049552502 Original CRISPR CGCCGTCCCCACGCTGCCCG CGG (reversed) Intronic
900549207 1:3245609-3245631 CGCCGTCCACAGGATGCCTGAGG + Intronic
901673103 1:10867303-10867325 GGCCGTCCCCGCGCCGCCCGCGG - Intergenic
902274689 1:15330968-15330990 CTCCATCCCCACCCTGCCCTAGG - Intronic
902725736 1:18334880-18334902 TGCCTCCCCCAGGCTGCCCGAGG + Exonic
904753425 1:32754933-32754955 CCCCGTCCCCACGGTCCCCGAGG + Intronic
906535770 1:46550309-46550331 TGCTGTCCCCACGCTTCCCCAGG + Intronic
910825679 1:91404753-91404775 CCCCGTCCCCACCTTCCCCGCGG + Intronic
915529131 1:156493421-156493443 CGCCCTCCCTCCGCTGCCAGGGG - Intronic
922783221 1:228269674-228269696 CCCCTTCCCCACGCTTCCCAGGG - Intronic
1067091297 10:43266895-43266917 CGCCGGCCGCGCGCTGCTCGGGG - Intronic
1069944162 10:71974542-71974564 CCCCGTCTCCACCCTGCCCCAGG - Intronic
1070877266 10:79826030-79826052 CCCCTCCCCCACGCTGCCCCCGG + Intergenic
1071643763 10:87342074-87342096 CCCCTCCCCCACGCTGCCCCCGG + Intergenic
1072248989 10:93567092-93567114 CACCATCCTCACGCTGGCCGCGG + Exonic
1072283837 10:93894313-93894335 CTCCGTCCCCACCCTGCCCGGGG + Intronic
1074182880 10:111078752-111078774 CGCCGTCGCCGCGCCGCCGGGGG + Exonic
1075877902 10:125823143-125823165 CCCCCTCCCCACGCAGCCCGAGG + Exonic
1076035282 10:127195239-127195261 CCCCGACCCCGGGCTGCCCGCGG + Intronic
1076850137 10:133088576-133088598 CGCAGCCCCCAGGCCGCCCGCGG + Intronic
1077074947 11:696068-696090 CTCCGCACCCACCCTGCCCGGGG - Intronic
1077216683 11:1397982-1398004 CGCCCTCCCACCTCTGCCCGGGG - Intronic
1077914704 11:6603738-6603760 CGCCGGCCCCGCCCCGCCCGTGG - Intronic
1079412457 11:20201793-20201815 CGCCTTCCCCACACTGCCACAGG + Intergenic
1080606666 11:33869761-33869783 CGCCGGCTCCGCGCCGCCCGCGG + Exonic
1080606702 11:33869857-33869879 CGCCGCCCCCTCTCTGCCCTCGG - Exonic
1083327757 11:61881809-61881831 CCCAGTCCCCAAGCTGCCCTGGG - Intronic
1083860618 11:65418217-65418239 CACAGACCCCACGCAGCCCGAGG + Intergenic
1084008410 11:66334982-66335004 CCCCGTCCCCGTGCTGCCAGGGG - Exonic
1084492522 11:69486584-69486606 CGCCCTCCCCTCGCTGTCCTGGG + Intergenic
1085512147 11:77093820-77093842 CACCCTGCCCACTCTGCCCGAGG - Intronic
1085561098 11:77473670-77473692 CGCCGCCGCCGCGCTGCCCGTGG + Exonic
1087227164 11:95614221-95614243 CGCCTTCCCCACTCTGCCACAGG - Intergenic
1088906314 11:114157879-114157901 GGCCCTCCCCACCCTGCCCCTGG + Intronic
1090801909 11:130178460-130178482 GGCCCTCCCCACGCAGCCCAAGG - Intronic
1092026212 12:5242916-5242938 CTCCGTCCCAACGCTGCCCTTGG + Intergenic
1097251227 12:57633091-57633113 AGCCCTCCCCGCGCTGCCAGTGG - Exonic
1102034770 12:109764942-109764964 CCCCATCCCGACTCTGCCCGGGG - Intronic
1102235730 12:111293468-111293490 TGCCGGGCCCACGCTGACCGAGG + Exonic
1105874735 13:24541553-24541575 AGCGGTCCCCACACAGCCCGGGG - Intergenic
1105920511 13:24958948-24958970 CCCCCTCCCCACTCTGCCCCCGG - Intergenic
1108643648 13:52406189-52406211 CGCCCTCCCCACGCCGTCGGGGG - Intronic
1111672458 13:91348052-91348074 CGCCGCCGCCACGCTGCCCCGGG - Intergenic
1113600962 13:111567916-111567938 TGTCGCCCCCACGCTGCCCTCGG + Intergenic
1113932032 13:113973770-113973792 CGCCGTCCACCCGCTCCCCGCGG + Intergenic
1122412285 14:101531787-101531809 CTCCGTCACCACTCTGCCCCTGG - Intergenic
1122917431 14:104865522-104865544 CGCCGGCCCAGCGCTGGCCGCGG + Intronic
1124118373 15:26867759-26867781 CGGCGTCCCGGCGCTGCTCGCGG + Intronic
1126064773 15:44818258-44818280 CGCCCTGCCCAGGCTGCCCAGGG + Intergenic
1126095064 15:45082335-45082357 CGCCCTGCCCAGGCTGCCCAGGG - Intergenic
1126109497 15:45167289-45167311 CGCCGTCCCCGGGCTGACGGGGG - Exonic
1126738108 15:51751790-51751812 CGCCGTGCCCTCCCTGCCCGCGG + Intronic
1127931656 15:63601041-63601063 CGCCGCCCCGCCGCTGCCCCCGG + Intronic
1128322347 15:66702475-66702497 AGCCCGCCCCACGCTGCCCTCGG - Exonic
1128344115 15:66842785-66842807 CGCGGCCCCCGCGCTGCCAGCGG - Intergenic
1128845592 15:70891999-70892021 CGCCGTGCCCACCCTGCACCGGG - Exonic
1131536897 15:93245207-93245229 CGCAGCCCCCACACTGCCTGCGG + Intergenic
1132549528 16:548588-548610 CGGGGTCTCCACGCTGCCCCTGG - Intronic
1133168555 16:3965750-3965772 CGGCGCCCACCCGCTGCCCGAGG - Exonic
1134656173 16:15949807-15949829 CGCCGGCCTCACGCGGCCCCCGG - Intronic
1135376763 16:21953768-21953790 CGCCGTCCTCCCGCTCCCCCTGG - Intronic
1136153737 16:28368427-28368449 CGCCGTCCACGCGCGTCCCGCGG + Intergenic
1136209355 16:28746843-28746865 CGCCGTCCACGCGCGTCCCGCGG - Intergenic
1136248758 16:28990032-28990054 CCCTGTCCCCACCCTGCCCTGGG + Intronic
1139420160 16:66844869-66844891 CGCCCGCCCCCCGCTGCCCTGGG - Intronic
1141079237 16:81036044-81036066 CGCTGTCCCCGCGCCGCCGGCGG + Exonic
1141724775 16:85780557-85780579 AGCCGTGCCCACGCTGGCTGGGG + Intronic
1142211872 16:88812278-88812300 CGAGATCCCCACGCTGCGCGCGG + Intergenic
1142217266 16:88835953-88835975 CCCCGTCCCCACGCGTCCCACGG + Intronic
1142217280 16:88835993-88836015 CCCCGTCCCCACGCGTCCCACGG + Intronic
1142217294 16:88836033-88836055 CCCCGTCCCCACGCGTCCCACGG + Intronic
1143105766 17:4529998-4530020 CTCCGTCCCCCAGCTGCCCGGGG - Intronic
1143750221 17:9022053-9022075 CGCCGCCCCCACGCCGCCCGAGG - Intronic
1146646417 17:34579951-34579973 CGCCGCCCCCACCCTGTCCCCGG - Intergenic
1148150039 17:45391510-45391532 AGCTGTGCCCACGCTGCCCCGGG - Intergenic
1148641631 17:49192393-49192415 AGCCCTCGCCACGCCGCCCGTGG + Intergenic
1148680448 17:49470518-49470540 CCCAGGCCCCAGGCTGCCCGCGG - Intronic
1151827045 17:76529438-76529460 TGCCCTCCCCACCCTGCCCTAGG - Intronic
1152107999 17:78341976-78341998 CCCCGCCCCCACCCCGCCCGCGG - Intergenic
1152361275 17:79834258-79834280 CGCCGCCCTCCCGCAGCCCGAGG - Exonic
1152728701 17:81959831-81959853 CGCCGTCCCTGAGCTCCCCGTGG - Intronic
1152888166 17:82864815-82864837 CGCTGTCCCCACGGTGCCCCGGG - Intronic
1152888181 17:82864853-82864875 CGCTGTCCCCACGGTGCCCCGGG - Intronic
1152888196 17:82864891-82864913 CGCTGTCCCCACGGTGCCCCAGG - Intronic
1155654286 18:28176914-28176936 CGCCCGCCCCACCCCGCCCGTGG + Intronic
1157384048 18:47247452-47247474 CGCGGGCTCCACGCCGCCCGCGG - Intronic
1160351182 18:78180724-78180746 CCCCGTCCCCCTGCTGCCCGGGG + Intergenic
1160456938 18:79008295-79008317 AGCCCTCTCCATGCTGCCCGAGG + Intergenic
1160873660 19:1287660-1287682 AGCCGTCCCCCAGCGGCCCGGGG - Intronic
1161006850 19:1941374-1941396 GGCCGCCCAGACGCTGCCCGCGG + Exonic
1161038829 19:2099362-2099384 CTCCGCCCCCACGTTGCCCTGGG - Exonic
1161219839 19:3113500-3113522 TGCCGTCCCCAGGCCGCCAGCGG - Intronic
1161266949 19:3368560-3368582 CGCTGTCCCCACTCTGGCCTGGG - Intronic
1161400805 19:4065715-4065737 CACCCTCCCCGCGCTCCCCGGGG - Intronic
1162019674 19:7862824-7862846 CGCGGTCCCGCCCCTGCCCGCGG + Intronic
1162141707 19:8589359-8589381 CGCCTTCTCCACGCAGCACGTGG - Exonic
1163462645 19:17448279-17448301 CGCCGGCCCCGGGCTGCCAGAGG - Exonic
1163547435 19:17948398-17948420 CGCCGTCCCCCCGGTGCTCGAGG - Intergenic
1163585468 19:18161282-18161304 CGCCGGCCCCACGGGCCCCGCGG - Exonic
1163663834 19:18594069-18594091 CGCCGTGCCCCGTCTGCCCGAGG + Exonic
1164470148 19:28523228-28523250 CGCCTTCCCCACCCTGCCCCAGG + Intergenic
1164753715 19:30674306-30674328 CCCTGTGCCCAGGCTGCCCGGGG + Intronic
1166765692 19:45251359-45251381 CGCCGCCCCCATGGCGCCCGGGG + Exonic
1167129177 19:47573148-47573170 CGCCTTCCCCGCGCCGCCCGGGG + Intergenic
1167454754 19:49592223-49592245 CCCCGTGCCCACTCTGCGCGCGG - Intronic
1168404162 19:56102319-56102341 CGCTGGCCCCACGCTGGCCGGGG - Intronic
929936300 2:46296941-46296963 CGCTGGCCCGGCGCTGCCCGCGG + Intronic
932965782 2:76473255-76473277 CGCCTTCCCCACCCTGCCACAGG + Intergenic
933614408 2:84469564-84469586 CACCTTCCCCACGCTGCCACAGG - Intergenic
937161433 2:119766120-119766142 CCCCCTCCCCACCCTGCCCCAGG + Intronic
938727317 2:134120227-134120249 CGCCGTGCCCACGCGGCCCGAGG - Exonic
941096587 2:161244858-161244880 CCCCTTCCCCACGCTTCCCAGGG - Intergenic
945704608 2:213213677-213213699 CGCCTTCCCCACCCTGCCACAGG - Intergenic
947815189 2:233032105-233032127 CGCCGCCCCCTCGCTGCCTCAGG + Intergenic
948505976 2:238427143-238427165 CGCCATCCCCACACGCCCCGCGG - Intronic
1172184112 20:33020713-33020735 CACTGTCCCCAAGCAGCCCGGGG - Intronic
1173812094 20:45962234-45962256 CCCCGTCCCCACCATGCCTGTGG + Intronic
1173849742 20:46210339-46210361 CGCCGTCACCACGCCGACCAGGG + Exonic
1175721947 20:61293027-61293049 TGTGGTCCCCACGCTCCCCGAGG + Intronic
1175789915 20:61734789-61734811 CTCCGTCCCCACCCAGCACGTGG + Intronic
1176244686 20:64091841-64091863 CGCCGGCCCCACACTGGACGGGG - Intronic
1179923730 21:44521443-44521465 CCCGGCCCCCACGCTGCCCTGGG + Intronic
1180090004 21:45529117-45529139 CGCCTTCTCCAGGCTCCCCGAGG - Intronic
1183301353 22:37060638-37060660 GGCCCTCCCCAAGCTGCCCAGGG + Intronic
1184516894 22:44967800-44967822 CGCTCTCCCCAGGCTGCCCTGGG + Intronic
1184651866 22:45923036-45923058 CTGCGTGCCCACGCTGCCCGTGG + Exonic
951208398 3:19947575-19947597 CGCGGTCCCCAGCCTGTCCGCGG + Intronic
954194916 3:48990680-48990702 CCGGGTCCCCACGCTGCCCCCGG + Intronic
955368785 3:58333129-58333151 CGCAGCCCCCTCGCGGCCCGGGG - Intronic
968170122 3:196503486-196503508 CGCGTTCCCCTCGCTGCCCCGGG - Exonic
968583345 4:1404924-1404946 CGCCGTCCCAGCCCTGCCCCGGG + Intronic
969641624 4:8402190-8402212 CCCCGTCCCCACCCGGCCCCAGG - Intronic
972818882 4:42676267-42676289 CGCCTTCCCCACCCTGCCACAGG + Intergenic
975556677 4:75672721-75672743 GGCCGTCGCCACCCCGCCCGTGG - Intronic
975661103 4:76689659-76689681 CGCCGCCCCCGGGCTGCTCGGGG - Intronic
984441369 4:179774580-179774602 CGCCTTCCCCACTCTGCCTCAGG + Intergenic
986330395 5:6713226-6713248 CGCCGTCCTCACCCCGCCCGCGG + Intergenic
992667473 5:79025310-79025332 CGCGGTCCCCACACTCTCCGAGG - Intronic
993980689 5:94540092-94540114 CGCCTTCCCCACCCCGCCTGAGG + Intronic
994353806 5:98773729-98773751 CGCCGAGCCCACGCTGGCTGGGG + Intronic
994746097 5:103680265-103680287 CTCCTTCCCCACACTGTCCGTGG + Intergenic
996398491 5:123036031-123036053 CGTGGTCTCCACGCTGGCCGCGG - Intronic
998095623 5:139394320-139394342 CGCCGTCTGCACGAAGCCCGCGG + Exonic
1002927165 6:1611263-1611285 CGCCGACGGCAGGCTGCCCGGGG - Exonic
1006617899 6:35342410-35342432 CGCCCACCGCACGCTGCCCCGGG - Intergenic
1015669190 6:135668306-135668328 CTCCGTCTCCACACTGCCTGAGG + Intergenic
1018060008 6:160082831-160082853 CGCCTTCCCCATGCTGCCTCAGG - Intronic
1019474175 7:1236163-1236185 CGCGGTCCCCGCGGCGCCCGAGG - Exonic
1019666500 7:2254600-2254622 GGCTGTCCCCTCGCTGTCCGTGG + Exonic
1019917701 7:4144172-4144194 CGCCGTCTCTAGGCTGCCCTCGG + Intronic
1020107262 7:5427931-5427953 CGCCGTCCCCTCGCTGCGACAGG + Intergenic
1023638596 7:42237136-42237158 CGCCTTCCCCGCGCGCCCCGCGG - Intronic
1024920276 7:54546713-54546735 CGCCGTCCCCGCGCTTTCCCCGG - Intronic
1024920293 7:54546766-54546788 CACCGCCCCCACGCTGTCCCTGG - Intronic
1024948201 7:54833173-54833195 CGCCGTCCCCTGGCTGCACAGGG - Intergenic
1032671785 7:134090588-134090610 CGCCTTCCCCACCCTGCCTCAGG - Intergenic
1034418958 7:150979131-150979153 CGCCCTCCCCCGGCAGCCCGGGG + Intergenic
1034921563 7:155087608-155087630 CACCGTCCCCACTGTGCCGGGGG + Intergenic
1035724841 8:1817949-1817971 CCCCAGCCCCACGCTGCCCCAGG + Intergenic
1036664871 8:10731446-10731468 TGCAGTCCCCAGGCTGCACGTGG - Intronic
1038540427 8:28386107-28386129 CGCCCTCCCGGCGCGGCCCGCGG + Intronic
1039837084 8:41265139-41265161 CTCCCTCCCCACCCTGCCCCCGG + Exonic
1041109413 8:54470574-54470596 CGCTGACCCCACGCAGCCAGCGG + Intergenic
1049552502 8:143267098-143267120 CGCCGTCCCCACGCTGCCCGCGG - Intronic
1049748538 8:144273064-144273086 GGCCCTCCCCACGCTGCTTGTGG - Intronic
1050388276 9:5112194-5112216 CGCCGGCCCCATGCTGCTGGTGG + Intronic
1051225333 9:14892804-14892826 CACCTTCCCCACTCTGCCCCAGG + Intronic
1054842598 9:69759758-69759780 CGCTGTCCGCCCGCCGCCCGAGG + Intronic
1057336206 9:94157078-94157100 CACCGTGGCCAGGCTGCCCGAGG + Intergenic
1059341690 9:113601024-113601046 CTCCTTCCCCACCCTGCCCCAGG - Intergenic
1060283445 9:122228698-122228720 CGCCGCCCCGGCGTTGCCCGAGG - Exonic
1061261268 9:129482285-129482307 AGGCGTCCCCACGCCGCCCGGGG - Intergenic
1061487083 9:130925382-130925404 CCCCGTCCCCACCCTGACCCTGG - Intronic
1061646728 9:132009015-132009037 CTCCCTCCCCACTCTGCCCGTGG + Intronic
1062363700 9:136199127-136199149 CGACGTCCCCGCGCCGGCCGGGG - Intronic
1185621729 X:1454075-1454097 CGCCCTTCCCACCCGGCCCGCGG - Intergenic
1188133908 X:26470999-26471021 CGCCTTCCCCACCCTGCCTCAGG - Intergenic
1190947448 X:55109579-55109601 CGCCGTCCCCACCCTGCCACAGG + Intronic
1192146203 X:68684549-68684571 CCCCTCCCCCACGCCGCCCGCGG - Intronic
1200000346 X:153056748-153056770 CCCCCTCCCCGCGCTGCCCCAGG - Intronic
1200107587 X:153723791-153723813 CACCGTCCCCACGGCGCCCGCGG + Exonic
1200714353 Y:6520587-6520609 CACCGTCTTCACTCTGCCCGAGG + Intergenic
1201019470 Y:9640569-9640591 CACCGTCTTCACTCTGCCCGAGG - Intergenic