ID: 1049552506

View in Genome Browser
Species Human (GRCh38)
Location 8:143267130-143267152
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049552495_1049552506 28 Left 1049552495 8:143267079-143267101 CCTGGAGTGCACGGAGGGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1049552506 8:143267130-143267152 CCCGAAGCCCGGCCCCGCGCTGG No data
1049552502_1049552506 9 Left 1049552502 8:143267098-143267120 CCGCGGGCAGCGTGGGGACGGCG 0: 1
1: 0
2: 3
3: 23
4: 155
Right 1049552506 8:143267130-143267152 CCCGAAGCCCGGCCCCGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr