ID: 1049554149

View in Genome Browser
Species Human (GRCh38)
Location 8:143273939-143273961
Sequence TCAGCTCTCCTCACGCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049554149_1049554152 -9 Left 1049554149 8:143273939-143273961 CCTGCTGGCGTGAGGAGAGCTGA 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1049554152 8:143273953-143273975 GAGAGCTGACCACTGGCCTCGGG No data
1049554149_1049554151 -10 Left 1049554149 8:143273939-143273961 CCTGCTGGCGTGAGGAGAGCTGA 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1049554151 8:143273952-143273974 GGAGAGCTGACCACTGGCCTCGG No data
1049554149_1049554153 -3 Left 1049554149 8:143273939-143273961 CCTGCTGGCGTGAGGAGAGCTGA 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1049554153 8:143273959-143273981 TGACCACTGGCCTCGGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049554149 Original CRISPR TCAGCTCTCCTCACGCCAGC AGG (reversed) Intronic
901514717 1:9737295-9737317 TCATTTGTCCTCACTCCAGCTGG + Intronic
903274442 1:22211695-22211717 CCAGCTCTCCTGATGCCAGAAGG + Intergenic
907448928 1:54529786-54529808 TCAGATATCCACACACCAGCCGG + Intergenic
915362871 1:155296139-155296161 TCAGCTCTCCTCAGTCCATGAGG - Intronic
915918515 1:159956619-159956641 TCAGCTTTCCTCACTCCAGGAGG - Intergenic
915918825 1:159959124-159959146 TCAGGTTTCCTCACTCCAGGAGG + Intergenic
922783066 1:228268777-228268799 GCAGCTCTCCTTCCGCCTGCAGG + Exonic
1064053951 10:12081728-12081750 TCGGGTCTCCTCACACCTGCGGG - Intronic
1064563176 10:16612857-16612879 TCTCCTCTCCTGATGCCAGCAGG + Intronic
1064725314 10:18273171-18273193 TCAGCTCACCTCAAGTCAACTGG + Intronic
1066225651 10:33380443-33380465 TCAGCTCTACTCTTGCGAGCTGG + Intergenic
1068851301 10:61744663-61744685 TCAGCCCTCCTCACACTAGGAGG + Intronic
1070772816 10:79092196-79092218 CCAGCACTCCTCACAGCAGCAGG - Intronic
1070806209 10:79272467-79272489 TCATCTCTCCTGACCTCAGCTGG - Intronic
1071499714 10:86194773-86194795 TCAGCCCTCCTCACCCCAACAGG + Intronic
1076033160 10:127176188-127176210 ACAGCTGTCCTCGGGCCAGCTGG - Exonic
1076494104 10:130885557-130885579 TCAGCTCTGCCAACACCAGCTGG - Intergenic
1076776165 10:132699400-132699422 GCTGCTCTCCTCATGCCATCAGG - Intronic
1076852752 10:133101108-133101130 TCAGGTCTCCTTCCTCCAGCCGG - Intronic
1077069662 11:662862-662884 TCAGCCCTCAGCACGGCAGCAGG + Intronic
1084409558 11:68998664-68998686 TCAGCTCACAACACGGCAGCTGG + Intergenic
1084433322 11:69123465-69123487 AGGTCTCTCCTCACGCCAGCGGG + Intergenic
1084795953 11:71504219-71504241 TCAGCTCGACTCATGCCAGGAGG - Intronic
1089155629 11:116400106-116400128 CCAGCTCTACCCACGCCAGAAGG + Intergenic
1090391497 11:126391684-126391706 TCAGCTCTCCTCCTGGCTGCTGG - Intronic
1099970328 12:89493737-89493759 TCTGCACTCCACACTCCAGCAGG + Intronic
1103212876 12:119179384-119179406 TCCCCTCTCCTCTCGCCTGCTGG + Exonic
1105451272 13:20502354-20502376 TCAGGTCTCCTCCCTCCGGCCGG + Intronic
1107210257 13:37844783-37844805 TCAGCTCACATTAAGCCAGCAGG + Intronic
1113010641 13:105761857-105761879 CCAGCTCTCCTCAGCCCAGAAGG - Intergenic
1113549662 13:111182663-111182685 TCAGCTCTGCCCCCGCCATCGGG + Intronic
1114259737 14:21027738-21027760 TCAGAAATCCTCACGCCAGGAGG + Intronic
1115689295 14:35826710-35826732 GCCGCTCTCCGCACGCCAGGCGG + Intronic
1118971807 14:70643234-70643256 GCATCAGTCCTCACGCCAGCTGG + Intronic
1121909446 14:97775916-97775938 CCAGCTCACCTCACCCCACCAGG - Intergenic
1122646460 14:103197673-103197695 CCAACTCTCCGCACGCCAACTGG + Intergenic
1122745941 14:103897287-103897309 TCAGCTTTCCCCAAACCAGCAGG + Intergenic
1122746281 14:103898959-103898981 GCTGCTCTCCTCACGACACCTGG + Intergenic
1125568450 15:40695395-40695417 GCAGCGCTCCTCTCTCCAGCAGG - Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1126795650 15:52258687-52258709 TCAGCTTTCCTCTAGGCAGCAGG - Intronic
1129313144 15:74726020-74726042 GCAGCGCTTCTCACGCGAGCCGG - Intergenic
1130937856 15:88485325-88485347 TAAGCTCTTCTCAGCCCAGCAGG - Intergenic
1131055595 15:89372614-89372636 TCATCTCTCCTCCAGACAGCTGG + Intergenic
1132766362 16:1536328-1536350 CCTGCTCACCTCAGGCCAGCAGG + Intronic
1132826728 16:1908983-1909005 TGAGCTCTCCGCATGGCAGCTGG - Intergenic
1133155655 16:3873739-3873761 TCAGCACTCCTAAGGCCAGCTGG + Intronic
1135022800 16:18976977-18976999 TCAACTCTCCTGACACCAGCTGG - Intergenic
1135269218 16:21054471-21054493 TCAGCTTCCCTCGCACCAGCTGG + Exonic
1136588190 16:31201440-31201462 TGAGCTCTGCACATGCCAGCAGG + Intergenic
1137300448 16:47143735-47143757 TGAGCTCTCCTCAGGGGAGCGGG - Exonic
1140092745 16:71851165-71851187 TCAGCTCTCCCGTAGCCAGCTGG - Exonic
1141384381 16:83605976-83605998 GGAGCTCTCCTCTCCCCAGCAGG - Intronic
1141863614 16:86734672-86734694 TGAGCTCTCCTCACACCCGCAGG - Intergenic
1142684685 17:1571094-1571116 TCAGCCCTCTTCCTGCCAGCAGG - Intronic
1143873764 17:9976439-9976461 ACAGCTCTCCTCTCCCCTGCAGG - Intronic
1144837091 17:18162218-18162240 GCAGCTCTGCTCATGCCAGCTGG - Intronic
1146320605 17:31843596-31843618 TCAGATTTCCTCAAGGCAGCAGG + Intergenic
1146922751 17:36724329-36724351 ACATCTCTCCTCATGCCTGCTGG + Intergenic
1147997858 17:44370945-44370967 TCAGCTCTACTCACCAAAGCTGG + Intergenic
1150575390 17:66426217-66426239 CCAGCACTCCCCACTCCAGCTGG - Intronic
1152655770 17:81518630-81518652 CCAGCTCTCCCCGCGGCAGCAGG + Intronic
1156770436 18:40714805-40714827 TCATCTCTCCTGCCTCCAGCTGG + Intergenic
1160587973 18:79923160-79923182 TCAGCCCCCCTCACTGCAGCCGG - Intronic
1161979750 19:7624261-7624283 TCAGCTCTCTCCCCACCAGCCGG + Intronic
1164795251 19:31021579-31021601 TCTGATCTTCTCACGCCATCTGG + Intergenic
926584115 2:14666380-14666402 TCAACTCTCCTCAAGTCACCCGG + Intergenic
926770246 2:16365658-16365680 TCTGCTCTTTTCACTCCAGCAGG - Intergenic
927869796 2:26616242-26616264 TCGGCTGACCTCAGGCCAGCTGG - Intronic
928087151 2:28352973-28352995 TCAGGCCTGGTCACGCCAGCTGG + Intergenic
941848822 2:170158833-170158855 TCACCTCTCATAACACCAGCTGG + Intergenic
942398856 2:175580379-175580401 TCTTCTCTCCTCACTCCACCTGG + Intergenic
942858600 2:180582654-180582676 TCAGATCTCCTTCCTCCAGCAGG + Intergenic
943543580 2:189246870-189246892 GCAGCTCTCCTCAGTCCAGAGGG - Intergenic
947628230 2:231634669-231634691 TCAGCTCTCCTGTCTCTAGCAGG - Intergenic
948048034 2:234958451-234958473 ACAGCCCTCCTCTGGCCAGCAGG - Intronic
948875883 2:240827777-240827799 CCAACTCTTCTGACGCCAGCTGG - Intergenic
1170457501 20:16547199-16547221 TCACCTCTCCTAAGGCAAGCTGG + Intronic
1171368685 20:24646018-24646040 CCAGCTCTCCTCTCTCCAGGTGG - Intronic
1172871236 20:38136703-38136725 TCTGCCCTCCTCACACCTGCAGG + Intronic
1173292393 20:41726378-41726400 TCTGCTCTCCCTACGCCAGCTGG + Intergenic
1174513999 20:51077144-51077166 CCAGCTCTCCTGACACCAGTGGG - Intergenic
1174688583 20:52479866-52479888 TCAGATCTCCTCCAGCCAGCCGG + Intergenic
1175465063 20:59185257-59185279 TCAGCTGTCATCTTGCCAGCAGG + Intergenic
1177218916 21:18165533-18165555 TCTGCTCTGCTCAGGGCAGCAGG + Intronic
1180744424 22:18078029-18078051 TCACCTCGCCTCCCGGCAGCGGG - Exonic
1182522859 22:30893993-30894015 CCAGCCCTACTCACGGCAGCGGG - Exonic
1184286540 22:43474988-43475010 TCAGCTCTGGTCTCACCAGCAGG - Intronic
1184475717 22:44720173-44720195 TCAGCTCAGCTCAGGCCAGGTGG + Intronic
1185002453 22:48254154-48254176 TCAACTCTCCAGACACCAGCTGG - Intergenic
954419229 3:50409853-50409875 TCAGGTCTCCTCGTGCCCGCTGG - Intronic
954703771 3:52467424-52467446 TCAGGCCTCCCCACGCCAGGAGG - Intronic
957480925 3:80792741-80792763 TCAGCCCTCCTTAGGCAAGCTGG + Intergenic
958142931 3:89586874-89586896 TCAGCTCTCCTAATGACATCTGG - Intergenic
961045191 3:123703303-123703325 CCAGCCCTCCTCCCGCCTGCTGG + Intronic
961393470 3:126570295-126570317 CCAGCTCCCCTCACCCCAGGAGG - Intergenic
968663157 4:1807094-1807116 TCACCCCGCCTCCCGCCAGCAGG + Exonic
971397155 4:26239122-26239144 TCCTCCCTCCTCAAGCCAGCCGG + Intronic
977556498 4:98492140-98492162 TCAGCCCTCACCAGGCCAGCAGG - Intronic
980002636 4:127508341-127508363 CCAGCTCTCCACACCACAGCAGG + Intergenic
981139752 4:141254510-141254532 TCAGCTCACTTCCAGCCAGCAGG + Intergenic
982828383 4:160028109-160028131 TCAGCACGCCTCACCACAGCAGG - Intergenic
983008106 4:162510360-162510382 TCAGCTCTCCTGACCCCTTCAGG + Intergenic
986381617 5:7192238-7192260 GCAGCTTTCCTCAGCCCAGCTGG + Intergenic
991399318 5:66236735-66236757 CCAACTCTCCACAAGCCAGCAGG - Intergenic
992752288 5:79872509-79872531 TCAGCTCTCCTCAGGGGACCTGG + Intergenic
993138040 5:83995253-83995275 TCAGCTCCCCTAACACCAGGGGG + Intronic
994065567 5:95536482-95536504 ACATCTCTGCTCATGCCAGCTGG + Intronic
995858145 5:116615141-116615163 TCTGCTCTCCTCAACTCAGCAGG - Intergenic
996837146 5:127805978-127806000 TGAGCTCTCTTCACATCAGCAGG + Intergenic
997628288 5:135346512-135346534 CCAGCTCTCCTCCTGGCAGCAGG + Intronic
997768210 5:136526246-136526268 TCAGCCCTCATCTCCCCAGCTGG - Intergenic
998489576 5:142534572-142534594 TCTGCCCTCCTCACACCAGCAGG + Intergenic
1007496203 6:42261618-42261640 TCAGCTGTCTTCATCCCAGCTGG + Intronic
1013543767 6:111135873-111135895 TCAGCTCTGCTCACAGCAGAGGG + Intronic
1017233335 6:152095387-152095409 TCAGCCCTCCTGACCTCAGCTGG + Intronic
1019039237 6:169089844-169089866 TCACCTCTCCACAGGGCAGCAGG - Intergenic
1019159956 6:170063072-170063094 TTAGCTCTGCGCACACCAGCAGG - Intergenic
1019268534 7:132618-132640 TCAGCTCCCGTCTCTCCAGCAGG - Intergenic
1020902369 7:14020914-14020936 TCAGCTCCCAACACGGCAGCTGG + Intergenic
1029439786 7:100581095-100581117 GCAGCCCTGCTCACCCCAGCAGG - Intronic
1030131157 7:106201628-106201650 TCTGCTGCCCTCACCCCAGCTGG - Intergenic
1032797472 7:135289277-135289299 CCAGCCCTCCTCACTCCTGCTGG + Intergenic
1032856797 7:135841813-135841835 TCTTCTCTCCTCTCCCCAGCGGG + Intergenic
1036593984 8:10195655-10195677 TCAGTTTTGCTCAGGCCAGCTGG - Intronic
1040988874 8:53327949-53327971 TGAGCTCCCTTCACGCAAGCAGG + Intergenic
1043297203 8:78680913-78680935 TCAGCCCTGCTCATTCCAGCTGG - Intronic
1045282807 8:100764127-100764149 CCAGCTCTCCTGAAGCCATCTGG + Intergenic
1045388473 8:101692625-101692647 TCAGCTCTCCTGTGGCCACCTGG + Intronic
1047233228 8:123015511-123015533 GCAGCTCGCCTCATGCTAGCAGG + Exonic
1047877066 8:129150213-129150235 TCAGCTCTACCCACACTAGCTGG + Intergenic
1048843354 8:138584046-138584068 TCAGCTCTCTTCACCTCACCAGG + Intergenic
1048987791 8:139744532-139744554 CCAGCTCTGCACACTCCAGCTGG + Intronic
1049554149 8:143273939-143273961 TCAGCTCTCCTCACGCCAGCAGG - Intronic
1050434383 9:5593452-5593474 CCAGCTCTCCAGACACCAGCTGG - Intergenic
1053100742 9:35370304-35370326 TCTTCTCTCCTCAGGCCAGCCGG + Exonic
1056126920 9:83543631-83543653 TCAGCTCTCCTGGGTCCAGCTGG - Intergenic
1056692930 9:88823599-88823621 TCAGCTGCCCACATGCCAGCTGG + Intergenic
1057017264 9:91663527-91663549 TCATCTCTGCTCAAGCCATCTGG - Intronic
1059681493 9:116590474-116590496 ACAGCTCTGCACAGGCCAGCAGG + Intronic
1061009723 9:127947921-127947943 TCAGGTCTCATCAGCCCAGCAGG + Intronic
1062109693 9:134775106-134775128 TCAGCCCTCCTGACTCTAGCTGG - Intronic
1062332728 9:136051613-136051635 TCCGCCCTCCTCCCGCCACCCGG - Intronic
1062544828 9:137057024-137057046 TCTGCTCTCCCCAGGCCAGTGGG - Intergenic
1188902578 X:35752343-35752365 TAAGCTCTCCTCACTTAAGCTGG + Intergenic
1189992282 X:46606894-46606916 GCAGCTGTCCTCACCCCATCGGG + Exonic
1193201668 X:78698448-78698470 TCAGCTGACATCACCCCAGCAGG - Intergenic
1195996031 X:110732499-110732521 TCCACTCTCTTCTCGCCAGCTGG - Intronic
1200755187 Y:6984345-6984367 TCAACCCTCCTCACCCCAGATGG + Intronic