ID: 1049554251

View in Genome Browser
Species Human (GRCh38)
Location 8:143274329-143274351
Sequence CCTGCAGTGCTGCTCTGGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 224}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049554251_1049554262 2 Left 1049554251 8:143274329-143274351 CCGGTCCAGAGCAGCACTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 224
Right 1049554262 8:143274354-143274376 GCTGGGGCATGGAGGAGGGTGGG No data
1049554251_1049554259 -3 Left 1049554251 8:143274329-143274351 CCGGTCCAGAGCAGCACTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 224
Right 1049554259 8:143274349-143274371 AGGATGCTGGGGCATGGAGGAGG No data
1049554251_1049554258 -6 Left 1049554251 8:143274329-143274351 CCGGTCCAGAGCAGCACTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 224
Right 1049554258 8:143274346-143274368 TGCAGGATGCTGGGGCATGGAGG No data
1049554251_1049554260 -2 Left 1049554251 8:143274329-143274351 CCGGTCCAGAGCAGCACTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 224
Right 1049554260 8:143274350-143274372 GGATGCTGGGGCATGGAGGAGGG No data
1049554251_1049554261 1 Left 1049554251 8:143274329-143274351 CCGGTCCAGAGCAGCACTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 224
Right 1049554261 8:143274353-143274375 TGCTGGGGCATGGAGGAGGGTGG No data
1049554251_1049554257 -9 Left 1049554251 8:143274329-143274351 CCGGTCCAGAGCAGCACTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 224
Right 1049554257 8:143274343-143274365 CACTGCAGGATGCTGGGGCATGG No data
1049554251_1049554263 18 Left 1049554251 8:143274329-143274351 CCGGTCCAGAGCAGCACTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 224
Right 1049554263 8:143274370-143274392 GGGTGGGCCACAGCCCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049554251 Original CRISPR CCTGCAGTGCTGCTCTGGAC CGG (reversed) Intronic
900102607 1:968268-968290 CCTGCAGAGCTGCTGTGCCCTGG - Intronic
900138568 1:1129103-1129125 CCTGCAGGGCTGTGCTGGCCAGG + Intergenic
900180058 1:1307441-1307463 CCTGCAGTCCAGCTCTGGCCAGG - Intronic
900224161 1:1524955-1524977 CCACCAGTGCTGCACTGGGCCGG + Intronic
900952510 1:5865851-5865873 CCTGCAGTGCTTCTGAGGATGGG - Intronic
902727737 1:18348413-18348435 CCTGCAGGCCTGCTCTGGCGGGG - Intronic
903111759 1:21141154-21141176 ACTGCATTGCTGCTGTGCACTGG - Intronic
905303946 1:37004893-37004915 CCTGCAGTGCTGGGCCGGGCTGG - Intronic
905482729 1:38272483-38272505 CCTGCAGGGGAGCTCTGGAGTGG + Intergenic
906530302 1:46520062-46520084 CCCACAGAGCTGCTCTGGGCTGG + Intergenic
907246843 1:53114204-53114226 TCTGCAGTGCTTCCCTGGAGAGG + Intronic
908385386 1:63636367-63636389 CCACGAGTGGTGCTCTGGACCGG + Exonic
908925102 1:69244480-69244502 CTTCCAGTGCTGCCCAGGACTGG + Intergenic
913162982 1:116162147-116162169 CCACCAGTGCTGCTGAGGACTGG - Intergenic
913198374 1:116476238-116476260 CCATCAGTGCTGCTATGGAGCGG - Intergenic
916465924 1:165074589-165074611 CCTCCCGTGCTGCTGTGGTCAGG - Intergenic
917717798 1:177755677-177755699 CCTGCAGTCCGCCTCTGCACAGG + Intergenic
917979597 1:180260700-180260722 CCTGCAGTGCTGGGGTGGCCAGG - Intronic
918318035 1:183339507-183339529 CCAGTACTGCTCCTCTGGACTGG - Intronic
919785146 1:201254040-201254062 CCTGCAGGGCTGGGCTGGGCTGG - Intergenic
919901567 1:202047588-202047610 CCTGCTCAGCTTCTCTGGACAGG + Intergenic
921014294 1:211173719-211173741 CCTGAAGGGCTGCCCTGGCCAGG - Intergenic
922189940 1:223309488-223309510 CTTGAAGTGGTGCTCAGGACTGG + Intronic
923456470 1:234169544-234169566 CTGGCTGTGATGCTCTGGACAGG + Intronic
1063704686 10:8419482-8419504 CCTGCAGTGCTGGTCAGGGCAGG + Intergenic
1065178583 10:23102565-23102587 CCTGATGTGATGCTCTGGAAAGG - Intronic
1065282139 10:24150458-24150480 CCTGCAGACCTTCTCTGGTCTGG - Intronic
1065954780 10:30684063-30684085 CCTGCAGGTCTCCTCTGGAAGGG - Intergenic
1067557974 10:47285551-47285573 CCTGCAGGACAGCTCTGCACAGG + Intergenic
1068738083 10:60437440-60437462 CCTGCAGTGCTGCAGGGGCCAGG + Intronic
1069727834 10:70592692-70592714 CCTGCAGTTATTCCCTGGACAGG + Intergenic
1070596690 10:77837720-77837742 CCTGCAGAGCTGATCAGTACTGG + Intronic
1070820836 10:79353188-79353210 CCTGCAGTTCTGCTCTTGGCTGG + Intronic
1076280356 10:129241716-129241738 CCTGCTGTCCTGCACTGGGCAGG - Intergenic
1076707634 10:132310313-132310335 CCTCCAGGGCTGATCTGCACTGG - Intronic
1076999084 11:313622-313644 GCTGCAGTCCTGCTCTGTGCGGG - Intronic
1077114294 11:876322-876344 CCTGTGGTCCTGCCCTGGACAGG - Intronic
1078095889 11:8296994-8297016 CCTTCAGTGCATCTCTGGGCAGG + Intergenic
1080022885 11:27581922-27581944 CCTGAAGGGCTGCCCTGGCCAGG - Intergenic
1083301068 11:61739841-61739863 CCTGGAGTCCTGCTCAGGGCTGG - Intronic
1083602946 11:63960283-63960305 TATGCAGTGCTGCCCTGGACAGG + Intergenic
1083650605 11:64202090-64202112 CTGACAGTGCTGCACTGGACAGG - Intronic
1083736752 11:64685860-64685882 TCATCAGTGCTGCTCTGGATGGG + Exonic
1084945061 11:72633959-72633981 CCTACTGTGCAGCTTTGGACAGG + Intronic
1088764328 11:112961837-112961859 CCTCCAGGGCTGCGCTGCACGGG + Intronic
1088835789 11:113577109-113577131 CCTGCTGTGCTGCTCTGTCTAGG + Intergenic
1089513601 11:119017377-119017399 CCTGAAGGGCTGCCCTGGCCAGG + Exonic
1090732013 11:129580409-129580431 CCTGTTGTGCTACTCTGCACAGG - Intergenic
1091243171 11:134068892-134068914 GATGCAGCGATGCTCTGGACCGG - Intergenic
1091402339 12:188736-188758 CCTGTACTGGTGCTCTGGGCAGG + Intergenic
1095945574 12:47751501-47751523 TAGGCAGTGCTGCTCTGGCCGGG - Exonic
1096529598 12:52234397-52234419 CCTGCTGGGCTGTTCTGGCCAGG + Intronic
1100228821 12:92586709-92586731 CCTTCAGTGCTAGTCTGGAAAGG + Intergenic
1102597091 12:114001172-114001194 CCTGCAGGGCTGCCCTGCCCAGG + Intergenic
1103764165 12:123269985-123270007 CCTGAAGTCCTGTTCTGGGCTGG - Intronic
1104546104 12:129714225-129714247 CATGGAGTGCTGCTCTGGGGAGG - Intronic
1105545579 13:21348294-21348316 CCTGCAGTGCTTCTCTGGGAGGG + Intergenic
1106178868 13:27354152-27354174 CCTGGAGGGCTGCTCTGAGCAGG - Intergenic
1107893557 13:44935895-44935917 CCTGCACTACTGTTCTGGACTGG + Intergenic
1112580705 13:100674607-100674629 CCAGCAGCGCCGCTCTGGCCCGG + Intronic
1113704247 13:112415708-112415730 CCTGTGGTGCTGCACTGGTCTGG - Intronic
1113879991 13:113619659-113619681 TCTGAAGTGCTGCTCGGGGCCGG + Intronic
1115405796 14:33014839-33014861 CCTGCTGTGCAGCTCTGGTGAGG - Intronic
1117402322 14:55369686-55369708 CCTGCACTGCTGCTCGCGATGGG + Exonic
1118257316 14:64216296-64216318 CTTGTAGTGATGCTCGGGACAGG - Exonic
1119266476 14:73265607-73265629 CCTGGAGTCCGGCTCAGGACTGG - Intronic
1119432678 14:74578692-74578714 CCTGCAGGGCTGTTGTGGACAGG - Intronic
1119481053 14:74958079-74958101 CTAGCACAGCTGCTCTGGACTGG - Intergenic
1119898243 14:78238796-78238818 CCCCCAGTGCTGGTCTGGGCTGG + Intergenic
1121464225 14:94103792-94103814 CCTGCGGAGTTGCTCTGGCCTGG + Intronic
1122792832 14:104191595-104191617 CCTGCGGTGCTGCTCTGTGATGG - Intergenic
1123067426 14:105625665-105625687 CCTGCCTTGCTGCCCTGGGCTGG + Intergenic
1123071443 14:105644389-105644411 CCTGCCTTGCTGCCCTGGGCTGG + Intergenic
1123076400 14:105669444-105669466 CCTGCCTTGCTGCCCTGGACTGG + Intergenic
1123091105 14:105742670-105742692 CCTGCCTTGCTGCCCTGGACTGG + Intergenic
1123505565 15:20939678-20939700 CGTGCAGTGCAGCCCTGGATAGG + Intergenic
1123562802 15:21513386-21513408 CGTGCAGTGCAGCCCTGGATAGG + Intergenic
1123599047 15:21950669-21950691 CGTGCAGTGCAGCCCTGGATAGG + Intergenic
1124420983 15:29521711-29521733 CGTGCAGTGCTGTTCAGGAGAGG - Intronic
1125333323 15:38603425-38603447 CCTGGAGTGCTGCCCTCGGCTGG + Intergenic
1127664846 15:61135660-61135682 CCTGCAGAGCTGCTTTTGCCGGG + Intronic
1130118533 15:81026599-81026621 CCAGCAGTGCTGCTATCGCCTGG + Intronic
1132113854 15:99121323-99121345 CCTGCAGTGCTGGGGTGGATGGG + Intronic
1132356292 15:101173784-101173806 CCTGCACTGCTGTTCTGGGCTGG - Intergenic
1202971154 15_KI270727v1_random:240519-240541 CGTGCAGTGCAGCCCTGGATAGG + Intergenic
1132745133 16:1433333-1433355 CCTGCCGGGCAGCTCAGGACAGG - Intergenic
1133741697 16:8656655-8656677 CCAGCAGTGCTGGCCTGGGCTGG + Intergenic
1138496628 16:57412855-57412877 CATGCAGTGATGCTGTGGCCTGG + Intronic
1138580470 16:57937713-57937735 CCTCCAGGGCTGCTTTGGACTGG - Intronic
1141256133 16:82404103-82404125 CCCGCGATGCTGCTCTGGAAGGG - Intergenic
1141322904 16:83028453-83028475 CGTGCAGTGCTCTTCAGGACTGG + Intronic
1142126816 16:88414535-88414557 CCGGCAGAGCTGCCCTGGATTGG + Intergenic
1142167413 16:88599687-88599709 CCTGCAGGGCTGCTGCGGTCGGG + Intronic
1142217856 16:88838584-88838606 CCTGCAGGGCTGCTGTGGGCCGG - Intronic
1142321066 16:89383316-89383338 CCTGCCTGGCTGCTCTGGAGGGG + Intronic
1142676467 17:1516557-1516579 CCCGCAGGGCTGCTCTGGCCGGG - Exonic
1143350028 17:6281172-6281194 CCAGCAGTTCTGCTATGGGCTGG - Intergenic
1143543499 17:7583055-7583077 CCTGCAGCGCTGCTTGGGAAAGG - Intergenic
1145015148 17:19391743-19391765 ACTGCAGTGCTCATCAGGACAGG - Intergenic
1145993677 17:29093716-29093738 CCTGCTGTGCTGCGCTGCACTGG - Intronic
1146723143 17:35137364-35137386 CCTGCATTGCTGCTTGGGAGAGG - Intronic
1147303669 17:39548988-39549010 TCTGCACTGCTGCTCTGCTCGGG - Intronic
1147479967 17:40751192-40751214 CCTGCGGTTCTGCTCTGCAAGGG + Exonic
1148969282 17:51465143-51465165 CCAGCAGTGGTGGGCTGGACAGG + Intergenic
1148988707 17:51646851-51646873 CCTGCAGTGCTGCTCCCTTCAGG + Intronic
1149425622 17:56551605-56551627 CCTTCAGTGCTTCTCTGCCCAGG - Intergenic
1152157239 17:78642414-78642436 CCTGCACTGGTGCACTGGCCAGG - Intergenic
1152179969 17:78813380-78813402 GCTGCAGAGCTTCTCTGGAGGGG - Intronic
1152219036 17:79050824-79050846 CCTGCAATCCTGCTCTGTACGGG + Intergenic
1153053576 18:924145-924167 CCAGCAGTGCTGTTCAGGAAGGG + Intergenic
1154350611 18:13580250-13580272 CCTTCCCTGCTGCTCTGGAGAGG + Intronic
1154465285 18:14637957-14637979 ACCCCAGTGCTGCTCTGGTCTGG + Intergenic
1155309381 18:24509267-24509289 CTTGCAGGGCTGCCCTGGGCAGG - Intergenic
1155390014 18:25325471-25325493 CCTGCAGTGGTGCTGGGGGCAGG - Intronic
1157374538 18:47150726-47150748 TCAGCAGTGGTGCTGTGGACTGG - Intronic
1157597997 18:48875457-48875479 CTTGCTGTGCTACTCTGGGCTGG - Intergenic
1158221824 18:55158736-55158758 CCTTCACTGAAGCTCTGGACTGG + Intergenic
1158829486 18:61262071-61262093 CCTGCACTGCTGCTCCCCACAGG - Intergenic
1159944069 18:74430594-74430616 CCAGCAGTGCTGGGCTGGACAGG - Intergenic
1160568735 18:79802387-79802409 CCAGCCGTGCTGCTCTGGTCCGG + Intergenic
1160754327 19:749850-749872 CCAGCAGGGCTGCTCAGGAGGGG - Intergenic
1160991057 19:1860513-1860535 CCTGGAGTGCTTCTCTGTAAAGG - Intronic
1160993642 19:1871968-1871990 CCTGCAGTCCTGCTGAGGAGGGG - Intergenic
1162904133 19:13813402-13813424 CCTGCAGTCCTGGGCTGGTCTGG + Intronic
1162904776 19:13817209-13817231 CCTGCAGAGCTGCTCCAGAAGGG + Exonic
1162964570 19:14149832-14149854 CCAGCAGCGCTGCTCTGCTCCGG + Exonic
1163756226 19:19107868-19107890 CCTGCTGGGCTGCTCTGTCCTGG + Intronic
1163763214 19:19148041-19148063 CCTGCTGTGTTGATCTGGGCAGG - Intronic
1165214535 19:34260991-34261013 GCTGCACTGCTCCTCTGGTCAGG - Intronic
1165369544 19:35395999-35396021 CATCCAGTGCAGCTCTGGGCCGG + Intergenic
1166033115 19:40147901-40147923 CCTGCAGGGCTGCCTGGGACTGG + Intergenic
925202496 2:1979816-1979838 CCTGCAGGGCTGGCCTGCACAGG - Intronic
925360718 2:3278448-3278470 CGTGCAGAGCTGCTCTGCCCAGG + Intronic
925753367 2:7109791-7109813 GCCGCAGTGCTGCACTGGAGGGG + Intergenic
926194940 2:10757660-10757682 CATGCAGTGCTGCCCAGGAGAGG - Intronic
927362320 2:22250248-22250270 CCAGCAGTGATTCTCTGGTCAGG + Intergenic
929549290 2:42879335-42879357 CCTGCAGTGCTGTTCTGAGGAGG + Intergenic
932412948 2:71558134-71558156 CTTGCTGTGCTGCTCTGTAATGG + Intronic
933614872 2:84473539-84473561 CCTCCAATGCTTCTTTGGACAGG + Intergenic
935359771 2:102237444-102237466 CCTGCAGTGCTGGAGTGGGCAGG - Intronic
935975148 2:108570809-108570831 TCTGCAGTCCTGCCCTGGAGGGG + Intronic
938082714 2:128378733-128378755 CCTGCAGACCAGCTCTGGAAGGG + Intergenic
938086534 2:128405674-128405696 CCGCCAGTGGAGCTCTGGACCGG + Intergenic
943027099 2:182643060-182643082 CCTGGAGGGCTGCACTAGACAGG - Intergenic
943305559 2:186257343-186257365 AATGCAGTGCTGCTCTGGGTTGG - Intergenic
948939505 2:241188940-241188962 CACTCAGTGCGGCTCTGGACGGG + Intronic
1170413542 20:16116000-16116022 CCTTCAGAGCTGGTGTGGACAGG - Intergenic
1170776642 20:19380501-19380523 GCTGCTGAGCTGCTGTGGACTGG + Intronic
1171488805 20:25502330-25502352 CCAGTAGTGCTGTTCTGCACTGG - Intronic
1172274534 20:33672561-33672583 CCTGCAGGGCTGAGCTGGGCAGG - Intronic
1174558490 20:51413124-51413146 CCAGCAGTGCTGCCCAGCACCGG - Intronic
1174778876 20:53370294-53370316 CCTGGGGAGCTGCTCTGGGCAGG + Intronic
1175820698 20:61907324-61907346 CCTGCAGTGGTCCTCTGCCCGGG + Intronic
1176058445 20:63161138-63161160 CCTCCATTGCTGCTCTGTCCCGG + Intergenic
1176257406 20:64159497-64159519 CCCTCAGTGCTGCCCTGGATGGG + Intronic
1176809255 21:13520429-13520451 ACCCCAGTGCTGCTCTGGTCTGG - Intergenic
1178909580 21:36663757-36663779 CCTGCAGAGCTTCCCCGGACTGG + Intergenic
1181419106 22:22785647-22785669 CCTGAGGTGCTGCCCAGGACAGG - Intronic
1182096302 22:27628273-27628295 CCTGCAGGGCTGCTATGGTTTGG + Intergenic
1182452967 22:30432258-30432280 ACTGCAGGGCTGCTCTGAACTGG - Intergenic
1183361030 22:37383609-37383631 CCTGCAGTTCAGCCCTGGGCTGG + Intronic
1183378934 22:37481004-37481026 CCTGTGGTGCTGCTCTGGAAAGG - Intronic
1184219786 22:43092401-43092423 CCTGAAGGGCTGCCCTGGCCAGG - Intergenic
1185210901 22:49569990-49570012 CCTCCAGGGCTGCTCTGCAGGGG + Intronic
1185250995 22:49801663-49801685 CCAGAAGAGCTGCTCTGGCCGGG + Intronic
950470924 3:13185892-13185914 GCAGCAGTTCTGCCCTGGACAGG - Intergenic
953530729 3:43737560-43737582 TCAGAAGTTCTGCTCTGGACAGG + Intergenic
953814634 3:46144438-46144460 CCTGCAGTGCTGCCCAGGCCAGG + Intergenic
954836609 3:53474814-53474836 CCTGTAGGGCTGCCCTGGCCAGG + Intergenic
954915081 3:54142036-54142058 CCTGAAGACCTGCTCTGGTCTGG + Intronic
955237712 3:57154641-57154663 CCTATAGTGCTGCTATGGACAGG - Intronic
957708911 3:83827859-83827881 CCTGCAGTGCTGAGCTCCACAGG + Intergenic
960157495 3:114310893-114310915 CCATCAGTGCTGAGCTGGACAGG + Intergenic
962412190 3:135151057-135151079 CCTACTGTGCTGCTCAGGCCAGG + Intronic
962898472 3:139736714-139736736 CTTGCAGTGGTGCTCTGGATGGG - Intergenic
963084390 3:141423110-141423132 CCTGCAGAGCTGATCTTGCCAGG + Intronic
964341471 3:155713108-155713130 TGTGGAGTGTTGCTCTGGACTGG - Intronic
968637237 4:1686872-1686894 GCTGCAGGGCTGTTCTGGGCAGG + Intergenic
969457758 4:7309895-7309917 CTTGCAGAGCTGCTCCGGAGAGG - Intronic
969659746 4:8519601-8519623 TCTGCAGCTCTGCTCTGGTCTGG + Intergenic
969691896 4:8708532-8708554 CCTGCAGAGGTGCACTGGGCAGG - Intergenic
975538762 4:75481077-75481099 TCAGCACTGCTGCTCTGGCCAGG + Exonic
975577379 4:75876458-75876480 CCTGCAGCGGTTCCCTGGACGGG - Exonic
985803024 5:2018352-2018374 CCTTAAATGCCGCTCTGGACGGG + Intergenic
995805900 5:116052020-116052042 CCTGAAGGGCTGCCCTGGCCAGG + Intronic
998109283 5:139488566-139488588 CCGGAAGTGCTGGTCTGGGCTGG + Intergenic
998450622 5:142231813-142231835 CCTGCTGTGGTGCCCTGGATGGG + Intergenic
999668516 5:153937454-153937476 TCTGCTGTGCTGCTCTGCAGTGG + Intergenic
999674717 5:153987506-153987528 CCTGCTGTTCTATTCTGGACAGG - Intergenic
1001389192 5:171365185-171365207 GCCGCAGTGCTGCCCTGTACTGG - Intergenic
1002071245 5:176680058-176680080 GCTGCAGTGCCGCTCTGCTCCGG + Intergenic
1002347134 5:178555872-178555894 CCTGCAGGGAGGCTCTGGCCAGG - Intronic
1003174826 6:3746665-3746687 CCTGCTCTGCTGCCCGGGACTGG + Intronic
1003195866 6:3914031-3914053 CCTGAAGGGCTGCTCTGGCCAGG + Intergenic
1003494771 6:6654149-6654171 GGTGCAGTGCTGCTATGGGCTGG - Intronic
1003513889 6:6802967-6802989 CCTGCGGTGGTGCCATGGACGGG - Intergenic
1003684072 6:8283217-8283239 CCTGCAGTGGTTATCTGGTCAGG + Intergenic
1004222599 6:13759388-13759410 CCTTCAGAGCTGCTCTGAGCTGG - Intergenic
1006898194 6:37484034-37484056 CCTGCAGAGCTGCTCTGGGCAGG + Intronic
1006944414 6:37775765-37775787 CCTGCAGTCCTGCTCCTGAGAGG - Intergenic
1009410429 6:63359831-63359853 CCTTCAGTTCTGCTCTGATCTGG + Intergenic
1011615417 6:89193563-89193585 CATCCAGTGGTGCACTGGACTGG + Intronic
1012416381 6:99018280-99018302 GCTGCATTGCAGCTCTTGACTGG - Intergenic
1024205387 7:47155047-47155069 TTTGCAGTGCTTCTCTGGGCTGG - Intergenic
1027190605 7:75993915-75993937 CCTGCAGGGACGCTCTGGCCTGG - Intronic
1027214335 7:76174125-76174147 CCTCCAGTTCTGGTCTGGGCAGG + Intergenic
1029510439 7:100991314-100991336 GATCCAGTGCTGCTGTGGACGGG - Exonic
1029511076 7:100995547-100995569 GATCCAGTGCTGCTGTGGACGGG - Exonic
1029511800 7:101000218-101000240 GATCCAGTGCTGCTGTGGACGGG - Exonic
1029512293 7:101003467-101003489 GATCCAGTGCTGCTGTGGACGGG - Exonic
1029706282 7:102278044-102278066 CCTGCAGAGCTACCCTGGCCGGG + Intronic
1029711989 7:102304727-102304749 CCTGCAGTGGAGGCCTGGACTGG - Intronic
1030281739 7:107783003-107783025 CCTGAACTGCTGATCTGGAGAGG + Exonic
1030677440 7:112398703-112398725 CCTGCAGGGTTGCTGTGGGCTGG + Intergenic
1032649657 7:133863792-133863814 CCTGCTTTGCAGCTCTGCACTGG + Intronic
1032850571 7:135791652-135791674 CCTGCAGTGTTGAGCTGGATGGG - Intergenic
1034327514 7:150250030-150250052 GCTGCAGGGCTGCCCTGGAGCGG + Intronic
1034740333 7:153467498-153467520 CCTGCAGTGCTCCCCTGCAGGGG + Intergenic
1034765698 7:153719415-153719437 GCTGCAGGGCTGCCCTGGAGCGG - Intergenic
1035378465 7:158423266-158423288 ACTGCCGTGCTGCTCAGGTCTGG - Intronic
1035682060 8:1495415-1495437 TCTGCTGTGCTGCTCTGAGCCGG + Intergenic
1036781663 8:11651905-11651927 CCTGCAGTGGTGCTCCCCACTGG - Intergenic
1037643709 8:20771498-20771520 CCTGCTGGGCTTCTCTGGCCTGG + Intergenic
1040336179 8:46417173-46417195 CCTGCAGGGCTTTCCTGGACAGG + Intergenic
1044427404 8:92068424-92068446 CCTGCAGCTCTGCTCTGTGCAGG + Intronic
1046471991 8:114687916-114687938 CTTACAGTGATGCTCTGTACTGG - Intergenic
1049384874 8:142338141-142338163 CCTCCAGTTCTGCTGTGAACAGG + Intronic
1049554251 8:143274329-143274351 CCTGCAGTGCTGCTCTGGACCGG - Intronic
1049572387 8:143375355-143375377 CCTCCTGTCCTGCTCTGGCCAGG + Intronic
1049615510 8:143574159-143574181 CGTGCAGTGCCACTCTGGCCAGG + Intergenic
1049785496 8:144448767-144448789 CCTGCAGAGCTGATGTGGCCTGG - Intergenic
1055142540 9:72892252-72892274 CCTGGAGTGCTGCTGAGGGCTGG + Intergenic
1059388701 9:113985309-113985331 GCTCCAGTGCTTCTCTTGACGGG + Intronic
1060471596 9:123952540-123952562 CCTGCAGTGCAGCTCTTGCAGGG + Intergenic
1060651575 9:125331963-125331985 ACTGGAGAGCTGTTCTGGACTGG + Exonic
1060659701 9:125397461-125397483 CCAGCAATTCTGCTCGGGACCGG - Intergenic
1062347260 9:136120716-136120738 CATGCTGTGCTTCTCTGGGCGGG - Intergenic
1062710642 9:137973375-137973397 CCTGCAAAGCTGCTCTAGGCTGG - Intronic
1185819574 X:3189055-3189077 CCAGCAGTGGTGCCCAGGACAGG - Intergenic
1186588060 X:10897955-10897977 CCTGCTGTGCGGCCCTGTACCGG + Intergenic
1187677699 X:21734300-21734322 CCTGCAGAACCGCTCTGGGCTGG - Intronic
1188438479 X:30189878-30189900 CCTGCACAGCTGCTATGGGCTGG + Intergenic
1190593771 X:52032586-52032608 TCAGTAGTGCTGCTCTGGGCAGG + Intergenic
1194033627 X:88844968-88844990 CCTCCAATGCTTCTTTGGACAGG + Intergenic
1195060089 X:101186019-101186041 CCTCCAATGCTTCTTTGGACAGG + Intergenic
1196860736 X:120025362-120025384 CCTGCAGTGGTAATCTGGTCTGG - Intergenic
1200218653 X:154379865-154379887 TCTCCAGTGCCGCTCTCGACCGG - Intronic
1200252227 X:154559747-154559769 CCTGCAGTGAGGCTGTGGAAGGG + Intronic
1200265541 X:154644669-154644691 CCTGCAGTGAGGCTGTGGAAGGG - Intergenic