ID: 1049554467

View in Genome Browser
Species Human (GRCh38)
Location 8:143275171-143275193
Sequence TAGGGGATGCAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1296
Summary {0: 1, 1: 0, 2: 13, 3: 142, 4: 1140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049554467_1049554477 2 Left 1049554467 8:143275171-143275193 CCCTCCTCCTCCTGCATCCCCTA 0: 1
1: 0
2: 13
3: 142
4: 1140
Right 1049554477 8:143275196-143275218 TGGCCTCCCCTCAGCCTGGTTGG 0: 1
1: 1
2: 1
3: 38
4: 259
1049554467_1049554482 15 Left 1049554467 8:143275171-143275193 CCCTCCTCCTCCTGCATCCCCTA 0: 1
1: 0
2: 13
3: 142
4: 1140
Right 1049554482 8:143275209-143275231 GCCTGGTTGGAGCTGTGTCCAGG 0: 1
1: 0
2: 1
3: 13
4: 239
1049554467_1049554476 -2 Left 1049554467 8:143275171-143275193 CCCTCCTCCTCCTGCATCCCCTA 0: 1
1: 0
2: 13
3: 142
4: 1140
Right 1049554476 8:143275192-143275214 TAGATGGCCTCCCCTCAGCCTGG 0: 1
1: 0
2: 2
3: 11
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049554467 Original CRISPR TAGGGGATGCAGGAGGAGGA GGG (reversed) Intronic
900100831 1:961276-961298 TCGGGGCTGCAGGAGGCGGGCGG - Exonic
900158920 1:1214218-1214240 CAGAGGAGGCGGGAGGAGGAAGG + Intergenic
900402791 1:2479453-2479475 TGGGGGCTGCAGGTGGAGGGAGG + Intronic
900540943 1:3202368-3202390 TAGGGGAGGCTGGGGGAGGCTGG + Intronic
900602551 1:3509350-3509372 TAGTGGAGGCAGTAGGAGGGTGG - Intronic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
900700803 1:4047556-4047578 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
900753745 1:4418633-4418655 GAGGGAAGGAAGGAGGAGGAGGG - Intergenic
900829008 1:4950683-4950705 GAGGGGCTGCAGGGGGAGGATGG + Intergenic
900851047 1:5143344-5143366 TAAGAGAAGCAGGAGGAGGGAGG + Intergenic
900968478 1:5975993-5976015 GAGGGGTTGAGGGAGGAGGAGGG + Intronic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901214932 1:7550004-7550026 GAGGGAAGGAAGGAGGAGGAGGG + Intronic
901229666 1:7634683-7634705 CTGGGGCTGCCGGAGGAGGAAGG + Intronic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901418904 1:9137081-9137103 TTGGGGATGCTGGAGGTTGATGG - Intergenic
901639914 1:10687967-10687989 TAGTGGGGGCAGAAGGAGGAAGG - Intronic
901644011 1:10706958-10706980 GAGAGGATGGAGGAGGAGGCCGG + Intronic
901748131 1:11388234-11388256 TGGGGGATGATGGAGGAGGTGGG + Intergenic
901773416 1:11542917-11542939 GAGAAGAGGCAGGAGGAGGATGG - Intergenic
902255719 1:15187429-15187451 TTGGGCATGCAGGAGGCTGAGGG + Intronic
902448892 1:16484472-16484494 TAGGGGAGGCAGGCAGAAGAAGG + Intergenic
902729067 1:18356917-18356939 TAGGGGATGGAGATTGAGGATGG + Intronic
903063600 1:20686138-20686160 GAGGGGATGGAGGAGAAAGAAGG + Intronic
903271407 1:22190593-22190615 TCAGGGAGGCAGGAGGAGGCTGG + Intergenic
903302740 1:22390773-22390795 TAGGGGAGGGAGGTGGAGGCTGG - Intergenic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
903841200 1:26242151-26242173 TAGGGTATGGAGTAGGTGGATGG + Intronic
904047656 1:27618183-27618205 GAGGGCAGGCAGGAGGGGGACGG + Intronic
904285838 1:29452812-29452834 ACGGGGATGCAGGAGGGGAAGGG + Intergenic
904493921 1:30876482-30876504 CAGGGGAGGGATGAGGAGGATGG - Intronic
904648494 1:31986718-31986740 GAGTGGGTGCAGGAGGTGGAGGG - Intergenic
904883780 1:33720444-33720466 AAGGGGATTCAGAAGGATGAAGG + Intronic
904949672 1:34226381-34226403 TAGAGGCTGGAGGAGGAAGAAGG - Intergenic
904978904 1:34480033-34480055 GGGGCAATGCAGGAGGAGGAGGG + Intergenic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905052657 1:35065208-35065230 TAGGTTGTGGAGGAGGAGGAAGG - Intronic
905364020 1:37439098-37439120 TGGGGGATGGAAGGGGAGGAGGG - Intergenic
905420969 1:37843839-37843861 GAGGGGAGACAGGAGGAGTAGGG - Intronic
905463357 1:38135397-38135419 AATGGGATGCTGGAGGAAGAAGG - Intergenic
905494919 1:38377431-38377453 TAGGTGATGGAGGTGGAGGTGGG + Intergenic
905787096 1:40767109-40767131 TTAGGGATGCAAGAGGAGGTAGG - Intronic
906169971 1:43716733-43716755 TAGGGACTGCATGAGGAGGCCGG + Intronic
906209283 1:44003153-44003175 CAGGGGCTGCAGCAGGTGGAGGG - Intronic
906270095 1:44470781-44470803 AGGAGGATGCAGGAAGAGGACGG - Intronic
906321859 1:44822297-44822319 GAGGGGATGCAGCAGCAGCAGGG + Exonic
906610623 1:47199388-47199410 GAAGGGATCCAGGAGAAGGATGG + Intergenic
906712208 1:47939190-47939212 TAGGGTATGCAGGCAGAAGATGG + Intronic
906747437 1:48231815-48231837 TTGGGGGTGAAGGAGGAAGATGG - Intronic
906817789 1:48897115-48897137 TAGGGGATGAAGGGGGAAAAAGG - Intronic
907245110 1:53103468-53103490 TACGGGGTCCAGGAGGAGAATGG - Exonic
907473446 1:54689615-54689637 TTGGGTTTGAAGGAGGAGGAGGG + Intronic
907481653 1:54749054-54749076 TAGGGAACACAAGAGGAGGAAGG - Intergenic
908239776 1:62179028-62179050 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
908627825 1:66066269-66066291 TAGGGGATGGAGGAGGCTGCGGG - Intronic
908979591 1:69939477-69939499 GAGGGGCTGGAGGAGGAAGAGGG - Intronic
909132433 1:71754630-71754652 TAGGGAATGCAGGTGGGGGTGGG - Intronic
909415252 1:75399088-75399110 TAGGAGATGGAGGTGGAGGAGGG + Intronic
909561834 1:77016181-77016203 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561842 1:77016205-77016227 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561850 1:77016229-77016251 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561858 1:77016253-77016275 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561866 1:77016277-77016299 GAGGAGATACAGGAGGATGAGGG - Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910570331 1:88694278-88694300 CAGGGGATGGAGGAGAGGGAAGG - Intronic
912077778 1:105898270-105898292 TAGAGGAAGCTGGAGGAGGGAGG - Intergenic
912395390 1:109338813-109338835 TGGGTGATGCCGGGGGAGGAGGG - Intronic
912551819 1:110489824-110489846 TCGGGGGTGGAGGAGGAAGAAGG - Intergenic
912804009 1:112741785-112741807 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
912949624 1:114111763-114111785 GAGGGGCTGCAGGAGGAGAGTGG + Intronic
913097673 1:115534835-115534857 AAGGGGATGGAGTAGGAAGAAGG - Intergenic
913494398 1:119415040-119415062 AAAGGGATTCTGGAGGAGGAGGG + Exonic
913515365 1:119600966-119600988 AAAGGGATGCTGGAGGAGGCAGG + Intergenic
913552316 1:119927610-119927632 AGGGGGAAGCAGGAGAAGGAAGG - Intronic
914758523 1:150580041-150580063 CAGGGGTTGAAGGAAGAGGACGG + Intergenic
915246392 1:154558756-154558778 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
915263014 1:154692888-154692910 TATGGGATGATGGAGGAAGAAGG + Intergenic
915269983 1:154747038-154747060 TAGGAGGTGCAGGAGGAAGAGGG - Intronic
915279178 1:154810603-154810625 TAGGGAAACCAGGAGAAGGAAGG + Intronic
915465117 1:156092819-156092841 TAAGGGAAGGAGGAGCAGGATGG - Intronic
915595205 1:156893209-156893231 TAGGGGCGGCAGGAGGAGAGGGG + Intergenic
915929917 1:160053990-160054012 TTGGGGATTGAGGTGGAGGAAGG - Intronic
915970243 1:160349833-160349855 AAGGGGAAGCAGGAGAGGGAAGG - Intronic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916116743 1:161491281-161491303 TAAGGGTTGCAGAAGGATGAAGG - Intergenic
916268333 1:162914912-162914934 TAGAAGATGTTGGAGGAGGATGG + Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
917141374 1:171839276-171839298 TAGGGGATGAAGGAGAGAGAGGG + Intergenic
917686969 1:177426288-177426310 TGGGGGATGAAGGAGCAGGATGG - Intergenic
918289316 1:183091492-183091514 GAGGGGAAGGAGGAAGAGGAAGG - Intronic
918653720 1:186998706-186998728 TGGGGGTTGCAGGAGGAGGATGG - Intergenic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
919176715 1:194028416-194028438 AGGGGGAGGAAGGAGGAGGAAGG - Intergenic
919420908 1:197369338-197369360 GAGGGGATGCAGGAGGAGAGGGG - Intronic
919518028 1:198551027-198551049 TAGTGGGAGAAGGAGGAGGAAGG + Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919914429 1:202130791-202130813 TAAGGGATGCAGGAAGGGGCCGG + Exonic
920073610 1:203321237-203321259 TAGGGGACGAGGGAGGAAGAAGG + Intergenic
920230583 1:204467157-204467179 TAGGGGAGGCAGGAGAGAGAAGG + Intronic
920492889 1:206431755-206431777 GAGGGGATGGAGAAGGAAGAGGG + Intronic
920517533 1:206597372-206597394 TAGGAAAAGCAGGAGGTGGAAGG + Intronic
920565623 1:206970446-206970468 AAGGGGACACAAGAGGAGGAAGG - Exonic
920910933 1:210215683-210215705 TAGAGTAGGGAGGAGGAGGAGGG + Intergenic
921078743 1:211721813-211721835 TAAGGGAAGGATGAGGAGGAAGG - Intergenic
921184145 1:212655787-212655809 GAAGGGATACAGGATGAGGAAGG - Intergenic
921308589 1:213821023-213821045 AAGGTGATGCAAGAGCAGGAGGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
922187975 1:223293206-223293228 TAGGGGTAAGAGGAGGAGGAAGG - Intronic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923833247 1:237581021-237581043 TAGGGGATGCAAGAGTAGAAGGG - Intronic
924198823 1:241639669-241639691 GAGGGGACGGAGGAAGAGGAAGG + Intronic
924207168 1:241725421-241725443 TAGGGGGTGTACGAGGAGGGAGG - Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062812525 10:477426-477448 GGGGGGAGGCAGGGGGAGGAAGG + Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063272642 10:4528640-4528662 AAGGAGATTAAGGAGGAGGAAGG + Intergenic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1063372262 10:5529515-5529537 TGGGGGCTGGAGCAGGAGGAAGG + Intergenic
1063556140 10:7081437-7081459 TGGGGAATGCAGGCAGAGGAGGG - Intergenic
1063593422 10:7412246-7412268 TTAGGGATGCAGGGCGAGGAAGG - Intergenic
1063901505 10:10737619-10737641 AAGGGGATTCAGGCAGAGGATGG - Intergenic
1065046616 10:21752049-21752071 TCGGGTATCCAGGAGGATGAGGG + Intergenic
1065624235 10:27614402-27614424 TCGGGGGTGAAGGAGGAGGAAGG - Intergenic
1065718080 10:28593352-28593374 TAGGGGATGGCAGAGGGGGAAGG + Intronic
1065993175 10:31032126-31032148 TCGGGGTTAGAGGAGGAGGAGGG + Intergenic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066235643 10:33481624-33481646 TAGGGGAGCCTGCAGGAGGAGGG + Intergenic
1066602842 10:37126028-37126050 CCGGGGCTGCAGGAGGAGGTGGG + Intronic
1066792445 10:39080803-39080825 TAGGGGTTGCAGGAGGATGAAGG + Intergenic
1067056950 10:43058060-43058082 TGGGGGATGGAGAAGGAGGGAGG - Intergenic
1067089460 10:43259206-43259228 TGTGGGATGCAGGAGCAGGCTGG + Intronic
1067237448 10:44462961-44462983 TGGGGGATGCAGGGGGTGGGAGG - Intergenic
1067804300 10:49382467-49382489 CTGGGGATGCAGGAAGATGAGGG + Intronic
1068958963 10:62847339-62847361 TAAGGGCTGCAGCAGGGGGATGG - Intronic
1069061481 10:63899344-63899366 TTGGGGTAGGAGGAGGAGGAGGG - Intergenic
1069286141 10:66717597-66717619 TAGGGGATGGTGGAAGAGCAAGG + Intronic
1069540952 10:69293407-69293429 TTGGAGATACTGGAGGAGGAAGG + Intronic
1069595101 10:69665199-69665221 TAGAGGCTGGAGGAGGAGGAGGG + Intergenic
1069651429 10:70052810-70052832 TAGCGGGGGGAGGAGGAGGAGGG - Exonic
1069776516 10:70930322-70930344 CAGGGGAGGCAGGAAGATGAAGG - Intergenic
1069839613 10:71331211-71331233 TAAGCCATGCAGGATGAGGATGG + Intronic
1070039112 10:72757407-72757429 TTGGGGAAGTAGGAGGAAGAAGG - Intronic
1070314238 10:75295225-75295247 GAGGGGTGGCAGGAGGAGGCAGG + Intergenic
1070330255 10:75411196-75411218 AAGGGGATGCTGGAGGAGGTTGG + Intergenic
1070394441 10:76000165-76000187 TTGGTGATGGAGGTGGAGGACGG + Intronic
1070544642 10:77442777-77442799 TTGGGTGTGAAGGAGGAGGAGGG - Intronic
1070568200 10:77619896-77619918 TGGAGGATGGAGGAGGTGGAGGG + Intronic
1070769433 10:79073698-79073720 TGGGGGGTGCAGAAGGGGGAAGG + Intronic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1070909804 10:80108115-80108137 TAAGGGTTGCAGAAGGATGAAGG - Intergenic
1071152233 10:82649245-82649267 AAGGGGAGGCAGGAGGTAGAGGG - Intronic
1071530522 10:86387819-86387841 TAGGGGAGATAGGAGAAGGAGGG - Intergenic
1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG + Intergenic
1071598946 10:86946969-86946991 AAGGGGCTGCAGAAGGAGGCTGG + Intronic
1071821328 10:89284155-89284177 GAGGGGTTGCTGGAGGAGGAGGG + Intronic
1071855027 10:89615430-89615452 CAGGAGATGAAGCAGGAGGAAGG - Intronic
1071877808 10:89861482-89861504 GAGGGGGAGGAGGAGGAGGAAGG - Intergenic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1073340915 10:102743990-102744012 GAGGAGAGGGAGGAGGAGGAGGG + Exonic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1073944337 10:108732420-108732442 TAAGGGTTGCAGAAGGATGAAGG - Intergenic
1074115089 10:110450870-110450892 TAAGGGAGGCAGGAAGAAGAAGG + Intergenic
1074364046 10:112843990-112844012 TGGGGTGTTCAGGAGGAGGAAGG + Intergenic
1074532194 10:114305447-114305469 GAGGGGACGCAGGTGCAGGAGGG + Intronic
1074532246 10:114305657-114305679 GAGGGGATGCAGGTGCAGGAGGG + Intronic
1074532451 10:114306355-114306377 GAGGGGATGCGGGGGCAGGAGGG + Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074765057 10:116694533-116694555 AAGGGGAGGGAGGAGGTGGAGGG - Intronic
1074856099 10:117474664-117474686 TAGGAGATGGAGGATGGGGATGG + Intergenic
1075212399 10:120502327-120502349 TAGGGGAGGCAGGGAGAGAAGGG + Intronic
1075688622 10:124380481-124380503 TTGGGGAGTCAGGAGGAGCATGG - Intergenic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1076009359 10:126974994-126975016 TATGGGAGGCAGGAGGAGGAAGG - Intronic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076553888 10:131309194-131309216 TAGGGGTTGCAAGAGCAGAAGGG + Exonic
1076732848 10:132446971-132446993 TGGGAGAAGCGGGAGGAGGAGGG + Intronic
1076816735 10:132918793-132918815 CAGGGGATGCAGGAGGAGTTGGG - Intronic
1076897907 10:133323142-133323164 GAGAGGAAGCAGGAGAAGGATGG - Intronic
1077068710 11:657268-657290 CAGGGAATGCAAGAGGAGGCTGG + Intronic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1077249083 11:1552841-1552863 CGGGGGCTGCAGGAGGAGGTAGG - Intergenic
1077368486 11:2170812-2170834 TAGGGGAGGGCGGGGGAGGACGG + Intronic
1077392575 11:2306919-2306941 GAGGAGATGGAGGAGGGGGAAGG + Intronic
1077483272 11:2826528-2826550 TCGGGGAAGCAGCAGCAGGAGGG - Intronic
1077578757 11:3403685-3403707 TGGGGGATGGCGGAGGGGGAGGG + Intergenic
1077592381 11:3502419-3502441 CAGGGGCTGCAGGAGGGGGTAGG - Intergenic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1078257901 11:9675719-9675741 CAGGGAATGCAGGAGAAGGAAGG - Intronic
1078523776 11:12085366-12085388 TGGGGGATCCAGGAGAAGGGTGG - Intergenic
1079105721 11:17571071-17571093 TAGGGGATGCAGAAGGAAACAGG + Intronic
1079129344 11:17738328-17738350 GAGGGGCTGGAGGAGGGGGATGG + Intronic
1079523491 11:21356808-21356830 TTGGGGATGCAGGATGAAGGAGG - Intronic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1080582639 11:33656713-33656735 TGGGGGAAGCTGGAGTAGGAAGG - Intronic
1080854364 11:36099183-36099205 TGAGGGATGCAGCTGGAGGATGG + Intronic
1081191203 11:40104707-40104729 TAGAGGACCCAGGAGGAGAAAGG - Intergenic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1081801876 11:45865674-45865696 GAGGGGCAGCAGGAGGCGGAGGG + Intronic
1081851029 11:46275452-46275474 AAGGGGTGGCAGGGGGAGGAGGG - Intergenic
1081906622 11:46674415-46674437 GAGAGGTTGGAGGAGGAGGAGGG - Intronic
1082097453 11:48142923-48142945 TAGGGGATCCATCTGGAGGAGGG - Exonic
1082693043 11:56328405-56328427 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1082784108 11:57307449-57307471 TTTGGGATGGAGGAGGAGAAGGG - Intronic
1082892424 11:58154177-58154199 GAGGGGAAGGAGGAGGAGAAGGG + Intronic
1082958414 11:58896248-58896270 TAGGTGATGCATGAAGAGGCTGG - Intronic
1082971463 11:59026596-59026618 TAGAGGTTGCAGGAGGTGGTAGG - Intronic
1083052281 11:59788004-59788026 CGTGGGAAGCAGGAGGAGGATGG - Intronic
1083745409 11:64733448-64733470 TGGGGCCTGCAGGAGGTGGAGGG + Intronic
1083799129 11:65036134-65036156 TTGGGGATGCTGGAGGTAGAAGG + Intronic
1083882025 11:65553532-65553554 TAGGGGAAGGAGGGGGAGGTGGG + Intronic
1083945271 11:65919711-65919733 AAGGGGGTGCTGGGGGAGGAAGG - Intronic
1084039414 11:66532681-66532703 AAGGGGGTGCAGGAGGCAGAGGG + Exonic
1084214688 11:67640929-67640951 TGGGGGATGTAAAAGGAGGAGGG + Intergenic
1084235785 11:67787201-67787223 TGGGGGATGGCGGAGGGGGAGGG + Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084728193 11:71055769-71055791 TAGGGGCTGGGGGAGGGGGAGGG + Intronic
1085246324 11:75104596-75104618 AAGGGGATGCAATAGGTGGAAGG + Intronic
1085510697 11:77086704-77086726 CAGGGGATGGAGTGGGAGGAGGG - Intronic
1085871887 11:80359822-80359844 TAGGAGGTGGAGGAGGTGGAAGG + Intergenic
1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG + Intergenic
1087026992 11:93659917-93659939 AAAGGGATGGAGTAGGAGGAAGG - Intergenic
1087359781 11:97143652-97143674 TAGGTGATACAGGAAGATGAGGG + Intergenic
1087701785 11:101443403-101443425 TAGGGAAGGCAGGACAAGGAAGG - Intergenic
1088194808 11:107262565-107262587 TAGGGGATTGAGGATGGGGAAGG + Intergenic
1088541443 11:110918034-110918056 TAGGAGATGAAGGAGGACAAGGG + Intergenic
1088645476 11:111913320-111913342 GAGGGGAGTCAGGAGGAGTAGGG - Intronic
1088798780 11:113286869-113286891 TAGGGGATGATGGAGGAGCTTGG - Intergenic
1088847684 11:113681785-113681807 TAGTGGATCCAGGAGGGGGCTGG - Intergenic
1089007608 11:115105563-115105585 TCGGGGAGGCAGGAGGTGGGAGG - Intergenic
1089067293 11:115671410-115671432 GAGGGGAAGAAGGAAGAGGATGG - Intergenic
1089593452 11:119559868-119559890 TGGGGGCTGCAGGAGCAGCAAGG - Intergenic
1089609693 11:119662569-119662591 AAGGAGATGCAGGAGGAGACAGG + Exonic
1089680997 11:120118866-120118888 TAGGGGTTGCAGGACGATGTGGG - Intronic
1089768027 11:120782698-120782720 TAGGGGGTGCTGAAGCAGGAGGG + Intronic
1089826827 11:121285214-121285236 TAAGGGTTGCAGAAGGATGAAGG - Intergenic
1089905227 11:122031424-122031446 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1090042695 11:123304550-123304572 TGAGGGATGGAGGAGAAGGATGG + Intergenic
1090042912 11:123306404-123306426 TGAGGGATGGAGGAGAAGGATGG + Intergenic
1090085676 11:123648844-123648866 AAGGGGATGAAGTAGTAGGAGGG + Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090546391 11:127771928-127771950 GGGGGGATACAAGAGGAGGAGGG + Intergenic
1090576128 11:128105764-128105786 TGGGGGATGGGGGAGGATGAGGG + Intergenic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091325030 11:134679636-134679658 TGGAGGAGTCAGGAGGAGGAGGG + Intergenic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091603089 12:1929800-1929822 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1091603174 12:1930052-1930074 GAGGGGGAGAAGGAGGAGGAGGG + Intergenic
1091603184 12:1930082-1930104 GAGGAGGTGGAGGAGGAGGAAGG + Intergenic
1091635600 12:2194286-2194308 GAGGAGGTGTAGGAGGAGGAGGG - Intronic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1091744499 12:2982513-2982535 TTGGGGAAGGAGGAGGAGGCTGG + Intronic
1091810336 12:3391619-3391641 TAGAGGATTCGGGCGGAGGAGGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092140791 12:6182108-6182130 CAGGGGATGGAGGAGGAGTTGGG + Intergenic
1092216628 12:6688534-6688556 TTAGAGATGGAGGAGGAGGAGGG + Intronic
1092239474 12:6828352-6828374 AAGGGGAGGGAGGGGGAGGAAGG - Intronic
1092279549 12:7089205-7089227 CAGGGGATCCAGGAGGAAGTTGG + Intronic
1092447778 12:8573683-8573705 TAGGGGTTGCAGGAGAAGAATGG + Intergenic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1093348768 12:18071223-18071245 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1093785967 12:23192660-23192682 TAGGGGAAGGAGGAAGAGGCAGG - Intergenic
1093991175 12:25591428-25591450 AAGGGGATGGAAGAGGGGGAAGG + Intronic
1094128818 12:27052764-27052786 TAGGGCCTGCAGGAGGGTGAAGG - Intronic
1094170507 12:27486336-27486358 AAGGGGATGCAGGAGAAGGCTGG - Intronic
1094293419 12:28877273-28877295 AAGGAGATGGAGGAGAAGGAAGG - Intergenic
1095345189 12:41141816-41141838 TTGGGGATGCAGGAGAGGGAAGG + Intergenic
1095540125 12:43299919-43299941 AAGGGGAAGGAGGAGGAGGTGGG + Intergenic
1095752778 12:45729627-45729649 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1096255328 12:50058737-50058759 GAGGGGATCCTGGGGGAGGAGGG - Exonic
1096280857 12:50252200-50252222 AAGTGAAGGCAGGAGGAGGAAGG + Intronic
1096503414 12:52079216-52079238 AAGGGGATGATGGACGAGGAAGG + Intergenic
1096630852 12:52925921-52925943 TAGGGGAGGAAGGAGGAGAAAGG + Intronic
1096649247 12:53053815-53053837 AAGGTGATGCTGGAGCAGGAGGG + Intronic
1097167565 12:57093849-57093871 AAGAGGATGAAGGAGCAGGAAGG + Intronic
1097282660 12:57854250-57854272 AAGGGGAGGAAGGAGGAAGAAGG + Intergenic
1097293924 12:57943070-57943092 TCAGGGAGGTAGGAGGAGGAAGG + Intronic
1097613603 12:61857762-61857784 GAGGAGGTGCAGGAGAAGGAGGG - Intronic
1097748709 12:63328810-63328832 TAGGGGAGGGAGGAGAAGGCTGG + Intergenic
1097794223 12:63844655-63844677 GAGGAGAAGTAGGAGGAGGAGGG - Exonic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098316991 12:69203134-69203156 TAAGGGTTGCAGAAGGATGAAGG - Intergenic
1098908808 12:76188536-76188558 TATGGGGTGCAAGAGAAGGAGGG - Intergenic
1099176695 12:79430466-79430488 TAGGGGCTGCAAGAGAATGAAGG - Intronic
1099413457 12:82359369-82359391 GAGGGGCTGCAGGTGCAGGACGG + Intronic
1100550689 12:95644204-95644226 GAGGGGAAGGAGGGGGAGGAGGG - Intergenic
1100874291 12:98945976-98945998 AAGGGGATGGAGAAGGTGGATGG - Intronic
1101403874 12:104411599-104411621 GAGATGATGCAGGAGGAGGAAGG - Intergenic
1101424283 12:104575378-104575400 TAAGGGATGCAGGAGGAACTGGG + Intronic
1101706532 12:107225735-107225757 AGGGGGAGGAAGGAGGAGGAGGG + Intergenic
1101725884 12:107387902-107387924 GAGGGGAAGCAGGAAGATGAGGG - Intronic
1101940787 12:109097836-109097858 TAGGGGGTGAAGGGGGAGGAAGG + Intronic
1102060291 12:109926380-109926402 TGGGGGATCCAGGAAGAGGCAGG + Intronic
1102201630 12:111061361-111061383 TTCGGGATGGGGGAGGAGGAGGG + Intronic
1102453219 12:113056670-113056692 GAGGGGGCGGAGGAGGAGGAAGG - Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102799154 12:115716469-115716491 TAAAGGAAGCAGGAGGAGGCTGG + Intergenic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103039715 12:117685132-117685154 CAGGGGATGGTGGAGGAGGCTGG - Intronic
1103057615 12:117834034-117834056 TGGGGGCTGAGGGAGGAGGACGG + Intronic
1103120809 12:118377680-118377702 GGAGGGATGGAGGAGGAGGAAGG + Intronic
1103367687 12:120394957-120394979 TTGGGGATGCAGAGGCAGGAAGG + Intergenic
1103607911 12:122101199-122101221 TATGTGATGAGGGAGGAGGAAGG - Intronic
1103631845 12:122267829-122267851 TAGAAGATGCTGGAGGAGGCCGG - Intergenic
1103892328 12:124249334-124249356 TAGGGAATGAAGGAGGGGGTGGG + Intronic
1103972120 12:124678892-124678914 CAGGGGAGGGAGGAAGAGGAGGG - Intergenic
1105038573 12:132944157-132944179 TCCGGAAAGCAGGAGGAGGAAGG - Intronic
1105738332 13:23295708-23295730 GAGAGGAAGAAGGAGGAGGAAGG - Intronic
1105864613 13:24448103-24448125 TGGGGGATGAGGGAGGAAGATGG + Intronic
1105935241 13:25092455-25092477 TGGAGGGTGCAGGGGGAGGAGGG - Intergenic
1106006440 13:25774406-25774428 TTGGGGAGGCAGGGGGAGGGAGG + Intronic
1106042940 13:26111234-26111256 TAGAGGAGGAAGGAGGAAGAGGG - Intergenic
1106314873 13:28584328-28584350 TAGGGGCTGAAGGAGGAAGCGGG + Intergenic
1106346420 13:28883664-28883686 AAGGGGTAGCAGGAGGAGGCAGG + Intronic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106933276 13:34690293-34690315 GAGGGGCAGCAGGAGGAGAAGGG - Intergenic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107430696 13:40337837-40337859 CTGGGGATGCACGTGGAGGAAGG + Intergenic
1107614515 13:42151003-42151025 AAGGGGCTGCAAGCGGAGGAAGG + Intronic
1108167878 13:47711684-47711706 TAGGGGATGAGGGAGGAAGGAGG - Intergenic
1108577120 13:51800104-51800126 TAGGGAATAAAGGAGGAGGATGG + Intronic
1108839357 13:54593272-54593294 TAGGGGATGCAGTGGTGGGAGGG - Intergenic
1108963897 13:56272407-56272429 TAAGGGCTGCAGAAGGATGAAGG - Intergenic
1110028710 13:70576676-70576698 TAGGGGGAGCAGGAGGAGGTGGG - Intergenic
1110275608 13:73639069-73639091 GATGGGATGCAGGAGGAGAGGGG + Intergenic
1110882408 13:80588204-80588226 TAGGAAATGCAGGCGGAAGAAGG + Intergenic
1111806398 13:93044116-93044138 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1112232263 13:97601117-97601139 TAGGGGAGCAAGGAGGATGAGGG + Intergenic
1112497532 13:99916534-99916556 TGGGGGATGAAGAGGGAGGAAGG - Intergenic
1112559358 13:100498661-100498683 TAGGGGTTGCTGGGGGAGGTGGG - Intronic
1113088419 13:106592236-106592258 TAGGCCAAGGAGGAGGAGGAGGG - Intergenic
1113447411 13:110379910-110379932 GAGAGGAGGCAGGTGGAGGAGGG - Intronic
1113494220 13:110714672-110714694 ACGGGGCTGCAGGAGGAGGGCGG + Intronic
1113646313 13:111998946-111998968 CGGGGGATGCAGGAGGAGAGAGG + Intergenic
1113661111 13:112106925-112106947 TAGGGGTAGGAAGAGGAGGAGGG + Intergenic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1113803810 13:113101807-113101829 GAGCAGAGGCAGGAGGAGGAGGG + Intergenic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1113957718 13:114108157-114108179 CAGGGGATGACGGAGGATGATGG - Intronic
1114083583 14:19220853-19220875 TGGCAGATACAGGAGGAGGATGG + Intergenic
1114318050 14:21525226-21525248 GAGGGGGTGGTGGAGGAGGAGGG + Exonic
1115315787 14:32023604-32023626 TGGGGGATGGAGGAAGAGGTGGG + Intergenic
1115704634 14:35986497-35986519 TAGGGGGAGCAGGATGTGGATGG + Intergenic
1115709960 14:36039746-36039768 TAGGGGAAGCCGGGGGAAGAAGG + Intergenic
1116130752 14:40854124-40854146 TAGGGGATCCAGGAACAGGGAGG + Intergenic
1116416968 14:44689811-44689833 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416974 14:44689826-44689848 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416980 14:44689841-44689863 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1117094343 14:52282300-52282322 TAGAACATGCAGGAGAAGGAGGG - Intergenic
1117555241 14:56877035-56877057 TGGGAGATGCAGGGGGTGGAAGG + Intergenic
1117737777 14:58785007-58785029 TAGGGGAAGCATGAGGATGGTGG - Intergenic
1118034884 14:61856079-61856101 AAGGGAGTGCAGGAGGAGGGAGG + Intergenic
1118339614 14:64883257-64883279 TAAAGGATACAAGAGGAGGAGGG + Intergenic
1118459543 14:65976004-65976026 GAAGGGAAGCAGGAGAAGGAGGG + Intronic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1118760622 14:68878559-68878581 TCGGGAAGGCAGGAAGAGGAAGG + Intronic
1119191714 14:72687552-72687574 TAGGGGATGCAGAGGAAAGATGG - Intronic
1119217608 14:72881106-72881128 TTGGAGCTGCAGGAGGATGATGG - Intronic
1119745083 14:77038303-77038325 TAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1119745374 14:77040144-77040166 TAACGGAGGGAGGAGGAGGAGGG - Intergenic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1119862830 14:77948878-77948900 TAGGGGAAGGGGGAGGGGGAAGG - Intergenic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1120746171 14:88153842-88153864 GAGAGGAGGCAGGAGCAGGAAGG + Intergenic
1120860192 14:89248071-89248093 GAGGGGTTGGAGCAGGAGGAAGG - Intronic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121605255 14:95235873-95235895 TCGGGCATGCAGGAGGCGGAGGG + Intronic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1122082427 14:99274745-99274767 GAGGGGGAGAAGGAGGAGGAGGG - Intergenic
1122153096 14:99735062-99735084 TAGGGGATGCGGAGGGACGAGGG + Intergenic
1122196539 14:100091574-100091596 CAAAGGATGCAGGAAGAGGATGG - Intronic
1122262412 14:100530933-100530955 TGGGGGACGCAGGAGGAGGTGGG + Intergenic
1122409016 14:101516759-101516781 ATGGGGATGCTGGAGGAGGTGGG - Intergenic
1122487989 14:102094535-102094557 AAGGGCATGCAGGAGAGGGAGGG + Intronic
1122775185 14:104113855-104113877 GAGGGGCTGCAGGTGGAGGGAGG + Exonic
1122842160 14:104471254-104471276 GGGTGGATGCAGGAAGAGGAGGG + Intergenic
1123043541 14:105500243-105500265 CAGAGGCTGCAGGTGGAGGAGGG - Intergenic
1123068110 14:105628256-105628278 GAGGGGGGGCAGGAGGAGCAGGG - Intergenic
1123123089 14:105927077-105927099 TGGGGGCTGTAGGAGGAGGCAGG + Intronic
1202895194 14_GL000194v1_random:2622-2644 TGGCAGATACAGGAGGAGGATGG + Intergenic
1123542316 15:21306563-21306585 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1123703735 15:22935617-22935639 TACTGGAGGCAGGAGGAGGAAGG + Intronic
1124028625 15:25989549-25989571 TAGGGGCTGCAGGCTGAGGGGGG + Intergenic
1124889072 15:33715011-33715033 CAAGGGATGCATGAGGAAGAAGG + Intronic
1125617824 15:41031489-41031511 GAGGGGAGGAAGGAGAAGGAAGG + Intronic
1125629427 15:41135011-41135033 TAGATGTTGCAGGAGCAGGAGGG - Intergenic
1125934054 15:43619390-43619412 TAGGGGATCCCGGAGGGGGAAGG - Intergenic
1125947151 15:43718852-43718874 TAGGGGATCCCGGAGGGGGAAGG - Intergenic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126114827 15:45199058-45199080 TGGAGGATGCAGCAGGAGGGAGG - Exonic
1126855464 15:52834660-52834682 AAGTGGGTGGAGGAGGAGGAGGG + Intergenic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128338411 15:66803143-66803165 ATGGGGAGGCAGGGGGAGGAGGG - Intergenic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1128585431 15:68845367-68845389 CACGGGATGCAGGTGGAGGGAGG - Intronic
1128740978 15:70083532-70083554 GAGGGGAGGGAGGAGGGGGAAGG - Intronic
1128762006 15:70223497-70223519 GAGGGGAGGCAGGAGGGGCAGGG - Intergenic
1128783360 15:70377421-70377443 GAGGGGAGGTTGGAGGAGGAAGG - Intergenic
1128797760 15:70477834-70477856 GAGGAGATGGAGGAGGAGGAGGG + Intergenic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1129009724 15:72404492-72404514 TAGGGGATTCCAGAGGAGGCTGG + Intronic
1129858092 15:78839393-78839415 TAGGGGTTGCTTGAGGAGGGTGG + Intronic
1129905757 15:79186074-79186096 TAGGTGAAGGAGGAGGAGAAAGG + Intergenic
1130397164 15:83512704-83512726 GAGGGGATGGAGGAGTAGGGAGG - Intronic
1130545734 15:84856842-84856864 AAGGGGATGCAGGGAGAGAAGGG + Exonic
1130630073 15:85558940-85558962 AAAGGGAGGGAGGAGGAGGAGGG - Intronic
1131407219 15:92175343-92175365 CATGGGATGCAGGAAGTGGAGGG - Intergenic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131689317 15:94809434-94809456 AAGGGGGTGAAGGAGAAGGAAGG + Intergenic
1131839293 15:96418346-96418368 TGGGGGTTGCAGGTGGAGAAAGG - Intergenic
1131852141 15:96554731-96554753 GAGGTGATGGAGGAGGAGGAGGG - Intergenic
1131866686 15:96718566-96718588 TTGGGGATGCAGGGGGAGGGGGG - Intergenic
1132028069 15:98419644-98419666 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
1132078977 15:98848440-98848462 TAGTGGATGCTTGCGGAGGATGG - Intronic
1202950633 15_KI270727v1_random:33704-33726 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1132539963 16:504128-504150 GAGGGGGTACAGGAGGAGGTGGG - Intronic
1132682401 16:1148458-1148480 GAGGGGCTGCAGGCGGAGGCTGG - Intergenic
1132934390 16:2473559-2473581 AAGGGGAAGCTGGCGGAGGAGGG - Intronic
1133212290 16:4270489-4270511 TAGGGGTTGCAGGGTGAGGTGGG - Intronic
1133230148 16:4362531-4362553 TAGGGTACACAGGAGGATGACGG + Intronic
1133346966 16:5077671-5077693 TTGGGGAAGCTGGGGGAGGAGGG + Intronic
1133347364 16:5079840-5079862 TGGGGGATGGCGGAGGGGGAGGG + Intronic
1133392789 16:5422898-5422920 GAGGGGAGGAAAGAGGAGGAGGG + Intergenic
1133392821 16:5422994-5423016 GAGGGGAGGAAGGAGGAGAAAGG + Intergenic
1133520183 16:6549264-6549286 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133520202 16:6549315-6549337 GAGGGGAGGAGGGAGGAGGAGGG + Intronic
1133520278 16:6549518-6549540 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133741072 16:8651862-8651884 TGGGGGATGGGGGACGAGGAGGG + Intergenic
1133935962 16:10269502-10269524 TAGGGGCTGAGGTAGGAGGATGG + Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134235037 16:12459022-12459044 GAGGGGGCGGAGGAGGAGGAAGG - Intronic
1134675640 16:16088479-16088501 TTAGGGATGCAGGATGAAGAGGG - Intronic
1134692071 16:16197631-16197653 GAAGGGGTGCAGGAAGAGGAGGG + Intronic
1135195470 16:20390497-20390519 TAGGGAATGCATGGGGTGGATGG - Intronic
1135224925 16:20647468-20647490 TAGGGGTTACAGAAGGATGAAGG - Intronic
1135304419 16:21356108-21356130 TGGGAGATGCAGTAGGAGGGTGG + Intergenic
1135434824 16:22419919-22419941 TGTGGGATGGAGGAGGAGGGAGG - Intronic
1135806958 16:25551432-25551454 TGGTGGAGGGAGGAGGAGGATGG + Intergenic
1136221905 16:28834607-28834629 TAGGGGATGTAGGAAGAATAGGG - Exonic
1136421615 16:30137633-30137655 TTGGGGAGGCGGGAGGAGGTTGG + Intergenic
1136574254 16:31113873-31113895 TAGGGGAAGTAGGAAGGGGAAGG + Intergenic
1136709573 16:32225378-32225400 TATTTGATGGAGGAGGAGGAGGG + Intergenic
1136758336 16:32704035-32704057 TATTTGATGGAGGAGGAGGAGGG - Intergenic
1136809772 16:33166340-33166362 TATTTGATGGAGGAGGAGGAGGG + Intergenic
1136816248 16:33276420-33276442 TATTTGATGGAGGAGGAGGAGGG + Intronic
1137442027 16:48505962-48505984 CAGGGAAGGTAGGAGGAGGAGGG + Intergenic
1137555323 16:49466856-49466878 TAGAAGTTGCAAGAGGAGGAAGG + Intergenic
1137585184 16:49660003-49660025 TTGCGGGTGGAGGAGGAGGAAGG - Intronic
1137833013 16:51562323-51562345 TATGGGAAGAAGGAGGGGGATGG + Intergenic
1138027267 16:53531764-53531786 TGGCAGATGCAGGAGGAGGAAGG - Intergenic
1138287394 16:55820797-55820819 TAGGGGAGGCAGGCAGAGGAAGG - Intronic
1138492753 16:57385929-57385951 CAGGAGATCCAGGAGGTGGAGGG - Intergenic
1138492964 16:57387300-57387322 TGGGGGATCCAGGAGGTAGAGGG + Intergenic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1138944889 16:61837135-61837157 TAAGGGGAGGAGGAGGAGGAGGG - Intronic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1139354956 16:66362012-66362034 TTTGGGTTGCAGAAGGAGGAAGG + Intergenic
1139425061 16:66874053-66874075 TAGAGGAGGAGGGAGGAGGAGGG - Intergenic
1139747206 16:69084132-69084154 TAGGAGATGCAGTTGGAGGTGGG + Exonic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1140113429 16:72022359-72022381 TAGGTGCTGCAGGAGAGGGATGG + Exonic
1140177660 16:72679951-72679973 CAGGGGCTGCAGGGTGAGGAGGG + Intergenic
1140275976 16:73509343-73509365 TAGGGGGTGGAGGGGGAGAAGGG - Intergenic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140376116 16:74446665-74446687 TAGAGGAGGAAGAAGGAGGAGGG - Intergenic
1140854709 16:78967881-78967903 CAGTAGCTGCAGGAGGAGGAGGG + Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141428819 16:83960526-83960548 GAGGGGCTGCTGGAGGAGGGCGG - Intronic
1141692701 16:85605642-85605664 CCGGGGGTGCAGGGGGAGGATGG - Intergenic
1141703599 16:85653236-85653258 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1141863335 16:86733108-86733130 GTCGGGATGCAGGAGGAGGCCGG - Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1141992447 16:87618299-87618321 AAGAGGAGGCAGGAGGAGGGAGG + Intronic
1142254330 16:89006715-89006737 GAGGAGATGGAGGAGGAGGGAGG - Intergenic
1142254355 16:89006776-89006798 GAGGAGATGGAGGAGGAGGGAGG - Intergenic
1142362237 16:89632941-89632963 GAGGGGCTGCAGGAGGAGGAGGG + Intronic
1203060487 16_KI270728v1_random:964382-964404 TATTTGATGGAGGAGGAGGAGGG - Intergenic
1203141663 16_KI270728v1_random:1771309-1771331 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141710 16_KI270728v1_random:1771452-1771474 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141815 16_KI270728v1_random:1771813-1771835 GAGATGATGGAGGAGGAGGAGGG - Intergenic
1142529637 17:571205-571227 TAGAGGCTGAAGTAGGAGGAGGG + Intronic
1142539545 17:647523-647545 CAGCGGATGGGGGAGGAGGAAGG - Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1142798078 17:2324666-2324688 GTGGGTATGAAGGAGGAGGATGG - Exonic
1143421000 17:6792285-6792307 GAGGGAATGTAGGAGAAGGAGGG - Intronic
1143727522 17:8859632-8859654 TAGGAGAAGAGGGAGGAGGAAGG + Intronic
1144051165 17:11498268-11498290 TTGGGGATGGAGGAGGAGGAAGG - Intronic
1144201232 17:12944179-12944201 TGTGGGATGCAGGAGGAGGTAGG + Exonic
1144579236 17:16448764-16448786 TTGAGGACACAGGAGGAGGAGGG + Intronic
1144656618 17:17041460-17041482 TAGGGGAAGAAGGAGCAAGAGGG - Intergenic
1145990382 17:29075761-29075783 CAGTGGAGGCAGGAGGAGTACGG - Exonic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146667641 17:34715613-34715635 GAAGGGATGGAGGTGGAGGAGGG - Intergenic
1147239306 17:39080074-39080096 TGGGGGATGGAGGATTAGGAAGG + Intronic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1147498777 17:40942374-40942396 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1147544944 17:41393989-41394011 TAGGGAATGCCAGAGGAGCAAGG - Exonic
1147587525 17:41660881-41660903 CAGGGGATTCACCAGGAGGAGGG + Intergenic
1147814908 17:43202215-43202237 TAGAGTATGCAGGAGGAGCATGG - Intronic
1147962367 17:44175856-44175878 TAGGGGAAAGTGGAGGAGGATGG + Intronic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148464746 17:47858092-47858114 TAGGGGCGGGAGGAGGAGGTGGG - Intergenic
1148544194 17:48504408-48504430 TAGGGGAGGCAGGTGGAGTGGGG - Intergenic
1148562046 17:48611878-48611900 TTGGGGGAGCAGGAGGAGAAGGG - Intronic
1148712358 17:49691098-49691120 TAATGGATGCAAGAAGAGGAAGG - Intergenic
1149176305 17:53876082-53876104 TAGGGGGTGCAGGGGGAGGAAGG - Intergenic
1149567467 17:57650306-57650328 CAGGGGATGCTGGAGGGAGAGGG - Intronic
1149926358 17:60705958-60705980 GAGGAGATGGAGGAGGTGGAAGG - Intronic
1150080520 17:62234425-62234447 TAGGTGGAGAAGGAGGAGGATGG - Intergenic
1150150901 17:62808235-62808257 TCGGGGAAGGAGGAGGAAGAGGG - Exonic
1150343215 17:64385408-64385430 TGGAGGGTGCAGGAGAAGGAGGG + Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150868099 17:68875866-68875888 TAGGGCAGGTAGGATGAGGAAGG + Intronic
1151325399 17:73376867-73376889 TCTGGGGTGAAGGAGGAGGAAGG - Intronic
1151470258 17:74313654-74313676 TGTGGCAGGCAGGAGGAGGAAGG - Intronic
1151496806 17:74462892-74462914 TGGGGGGTGCAGGAGGAGTGGGG + Intergenic
1151560330 17:74866392-74866414 CAGGGGCTGCAGAAGGAGGCCGG - Intronic
1151588852 17:75029923-75029945 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152008498 17:77696852-77696874 GAGGGGAAGGAGGAGGAGAAGGG - Intergenic
1152031204 17:77844581-77844603 CAGGGGCTGGAGGAGGAGGAAGG + Intergenic
1152268613 17:79310643-79310665 TGGGGAATGCGGGAGGAGGGTGG - Intronic
1152368320 17:79870220-79870242 GAGGGGAAGTGGGAGGAGGAAGG - Intergenic
1152482633 17:80565409-80565431 TGGGGGGTGTAGGAGGAGCAAGG + Intronic
1152659333 17:81535224-81535246 ATGGGGATGATGGAGGAGGAAGG - Intronic
1152739620 17:82013227-82013249 GAGGGGATGGAGACGGAGGAAGG - Intronic
1152838417 17:82550366-82550388 AAGGGGGTGCAGGAGCAAGATGG + Intronic
1152863420 17:82709116-82709138 TGGGGGATGGAGCAGGGGGAGGG - Intergenic
1152946271 17:83199151-83199173 GAGGGGCTGGAGGAGGAAGAGGG - Intergenic
1153410700 18:4789455-4789477 TGGAGGATGCAGTGGGAGGAGGG - Intergenic
1153922823 18:9806429-9806451 TTGAGGATGCTGGTGGAGGAGGG + Intronic
1154353560 18:13607581-13607603 TGGGGGAGGCAAGGGGAGGAAGG - Intronic
1154500262 18:14992515-14992537 TGGCAGATACAGGAGGAGGATGG + Intergenic
1155032786 18:21998767-21998789 TAGGGATGGCAGGGGGAGGAGGG + Intergenic
1155066538 18:22273768-22273790 AGGAGGATGGAGGAGGAGGAGGG - Intergenic
1155066546 18:22273791-22273813 AGGAGGATGGAGGAGGAGGAGGG - Intergenic
1155208390 18:23580279-23580301 TAGGGGAGGCAGGAGGACAAGGG - Intronic
1156856371 18:41786217-41786239 GAGAGGAGGCAGCAGGAGGAGGG + Intergenic
1157110559 18:44816416-44816438 GAAGGGGTGCAGGAGGAGAAGGG + Intronic
1157490796 18:48122420-48122442 TAGGGTATGAGGGAGGTGGAGGG + Intronic
1157551227 18:48583053-48583075 GAGGGGAGGGAGGAGGATGATGG + Intronic
1157570198 18:48707104-48707126 TGGGGAGTGCAGGAGGTGGAGGG + Intronic
1157572879 18:48724550-48724572 TAAGGGGTGGAGGAGTAGGAAGG - Intronic
1157695951 18:49723760-49723782 TGTGGGATGCAGGAGAAGGGCGG + Intergenic
1158349324 18:56549125-56549147 TAGGAGAAGCGGGTGGAGGATGG + Intergenic
1158367851 18:56759453-56759475 TAGGAGATGGAGGAGAAGAAAGG + Intronic
1158375299 18:56856797-56856819 TAGGGGAGGAGGCAGGAGGACGG - Intronic
1158427372 18:57352363-57352385 GAGGGGGTGCAGGAGAGGGAGGG - Exonic
1158516900 18:58138334-58138356 GAGGGGAGGGAAGAGGAGGAGGG - Intronic
1158516907 18:58138352-58138374 GAGGGGAGGGAAGAGGAGGAGGG - Intronic
1158516914 18:58138370-58138392 GAGGGGAGGAAAGAGGAGGAGGG - Intronic
1159053395 18:63442559-63442581 TAAAGGAAGAAGGAGGAGGAGGG + Intergenic
1160429025 18:78798943-78798965 AAGGCGATGCAGGAGGACGGCGG + Intergenic
1160448626 18:78946975-78946997 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1160454949 18:78993465-78993487 TAGGGGATGCCCGAGCAGGTGGG - Exonic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160623526 18:80187609-80187631 CAGGGGAGCCAGGAGGTGGATGG - Intronic
1160829834 19:1098589-1098611 GAGGGGAGGCAGCAGCAGGAGGG + Intergenic
1160869995 19:1273338-1273360 TAGGGGAGCCAGGCGGGGGACGG + Intronic
1161022239 19:2015786-2015808 TAGGGGGAGGAGGGGGAGGAGGG + Intronic
1161085440 19:2332963-2332985 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161085461 19:2333024-2333046 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161085499 19:2333145-2333167 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161279360 19:3436969-3436991 TGGGAGCTACAGGAGGAGGAAGG + Intronic
1161286051 19:3468870-3468892 GAGGAGAAGTAGGAGGAGGAGGG - Intronic
1161347907 19:3777290-3777312 TGGGGGAGGCAGGAGGAGGAGGG + Intergenic
1161448299 19:4329918-4329940 GAGGGGCTGCAGGATGGGGACGG - Intronic
1161964403 19:7540324-7540346 CAGGGGCTGCTGCAGGAGGATGG + Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162725494 19:12687926-12687948 TGGGGGCTGCAGGATGAGGGTGG - Intergenic
1162740602 19:12771504-12771526 TCAGGGATTCAGGAGAAGGACGG + Intronic
1162802465 19:13118780-13118802 TCGTGGATGCCGGAGGGGGAGGG + Intronic
1163177171 19:15572466-15572488 TGGGGAAGGCATGAGGAGGATGG + Intergenic
1163264017 19:16207460-16207482 TGGGGGATGCGGGAAGGGGAAGG + Intronic
1163501031 19:17676363-17676385 CAGGGGATGCAGGGAGAGGGAGG - Intronic
1163721339 19:18899585-18899607 GAGGGGATGCAGGTGGATGCCGG + Exonic
1163962592 19:20711216-20711238 TAGGGGTTGCAGAAGGATGAAGG + Intronic
1164249610 19:23465629-23465651 TAGGAGGTGGAAGAGGAGGAGGG - Intergenic
1164322948 19:24167048-24167070 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1164441897 19:28285128-28285150 GAGGGGAAGAAGGAGAAGGAGGG + Intergenic
1164592167 19:29513051-29513073 TAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164611963 19:29638458-29638480 TAGGGAATGCAGGAGGGTAAGGG + Intergenic
1165655074 19:37525994-37526016 GAAGGGATGGAGGAGGAGGCAGG - Intronic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1165796585 19:38523475-38523497 GAGAAGATACAGGAGGAGGAAGG - Intronic
1165796601 19:38523551-38523573 GAGAAGATACAGGAGGAGGAAGG - Intronic
1166359900 19:42248719-42248741 TAGGGGGTGCAGGTGGGGCACGG + Exonic
1166384990 19:42375874-42375896 CTGGGGATCCAGGAGGAGCAGGG + Exonic
1166672445 19:44719004-44719026 GAGGAGGTGGAGGAGGAGGAGGG + Intergenic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167322739 19:48806527-48806549 TAGTGGAGGCTGGAGGAGGCTGG + Exonic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1167505132 19:49867275-49867297 TAGTGGATGTGGGAGGAGGCGGG - Intronic
1167609891 19:50501933-50501955 GAGGTGATGAAGGAGGAGGGTGG - Intergenic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167725754 19:51211758-51211780 ACGGGGATGCAGGATCAGGAAGG - Intergenic
1167727422 19:51225766-51225788 GAGGGGATGCAGAATCAGGAGGG - Intronic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1168333127 19:55580881-55580903 TGGGGGGTGGAGGAGGAGGCTGG + Intergenic
1168488251 19:56783660-56783682 TAGGGAATACAAGAGGAGGCAGG + Intronic
1168514980 19:57003629-57003651 CAGGGGCTGCAAGAGGAGGAGGG - Intergenic
1168723625 19:58569167-58569189 TTGGGGATGCTGGAGTAAGAGGG + Intronic
925020574 2:564711-564733 AAGGAGGTGCAGGAGGAGGAGGG - Intergenic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
925157935 2:1661533-1661555 GCAGGGATGCAGGTGGAGGATGG + Intronic
925733962 2:6944175-6944197 TTGGAGATGCGGGAGGAGGCCGG + Intronic
925937110 2:8774692-8774714 TAAGGGATGGAGGAGGAGAATGG + Intronic
926105444 2:10146721-10146743 AAGGGTAGGGAGGAGGAGGAGGG + Intronic
926558306 2:14386564-14386586 GAGGAGAAGCAGGAGGGGGAGGG + Intergenic
927076284 2:19581088-19581110 GATGGAATGCAGGAGGAGGAAGG + Intergenic
927413871 2:22856339-22856361 TAGGCCACACAGGAGGAGGAAGG + Intergenic
927606632 2:24491731-24491753 TCGGGGAAGTGGGAGGAGGATGG - Intergenic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
927698013 2:25251086-25251108 TAAGGGCTGGCGGAGGAGGAAGG + Intronic
927702236 2:25275927-25275949 GAGGGGGTGCGGAAGGAGGAGGG + Intronic
927705637 2:25294879-25294901 AATGGGAGGGAGGAGGAGGAGGG - Intronic
927812469 2:26187667-26187689 GAGGGGGCGCAGGAGGAGGGGGG - Exonic
928116203 2:28546648-28546670 TTGGGGATGCAGGAGAAGAAAGG + Intronic
928158232 2:28895383-28895405 AAGGGGGGGCAGGAGGGGGAAGG - Intronic
928373642 2:30758671-30758693 TCCGGGATGCAGGACGAGGAGGG - Intronic
928943632 2:36752660-36752682 TAGGAGACACTGGAGGAGGAGGG - Intronic
928979060 2:37119429-37119451 TAGAGGAGGCAGGAGGAACAGGG + Intronic
929778265 2:44941960-44941982 AGGGGGGAGCAGGAGGAGGAGGG - Exonic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931430147 2:62202851-62202873 GAAGGGAGGTAGGAGGAGGAGGG - Intronic
931778028 2:65556677-65556699 TTGCGGAAGCAGGAGGTGGATGG + Intergenic
931985388 2:67736657-67736679 AAGGGGATGGAGGAGGAGAATGG - Intergenic
932301091 2:70667388-70667410 TAGAGGCTGGAGGAGGAGGGGGG + Intronic
932435176 2:71699203-71699225 GGGGGGATGGAGGAGAAGGAGGG - Intergenic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
933614665 2:84471423-84471445 TAGGAGTTGCAGAAGGATGAAGG + Intergenic
933725017 2:85421758-85421780 TGGGGCCTGCAGGAGGAGGGAGG + Intronic
934159479 2:89234830-89234852 AAGGAGATGAGGGAGGAGGAGGG - Intergenic
934207798 2:89947601-89947623 AAGGAGATGAGGGAGGAGGAGGG + Intergenic
934731800 2:96663528-96663550 TAGGGGATGTGGGAGAAGGGTGG - Intergenic
934942575 2:98513167-98513189 GAGGCGATGCAGGAGGAGTTGGG - Intronic
934987874 2:98900401-98900423 GAGGGGAGGCAGGAGGATGGAGG + Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
936416201 2:112315276-112315298 TAGGGGACTCAGGAGAAGTAAGG + Intronic
937673619 2:124564999-124565021 TTGGGGATGCAGAAAGAGCATGG + Intronic
938095116 2:128456516-128456538 AAGGGGAGGCAGGGGGATGAGGG - Intergenic
938178942 2:129162513-129162535 GAGGGGCAGAAGGAGGAGGAAGG + Intergenic
938207791 2:129438763-129438785 TGTGGGAGGCAAGAGGAGGATGG - Intergenic
938239605 2:129733203-129733225 TTGGTGAGGCTGGAGGAGGAGGG - Intergenic
938341167 2:130537558-130537580 GGGGGGGTTCAGGAGGAGGATGG + Intergenic
938348664 2:130583151-130583173 GGGGGGTTTCAGGAGGAGGATGG - Intronic
938493005 2:131775780-131775802 TGGCAGATACAGGAGGAGGATGG - Intergenic
938970219 2:136424707-136424729 CAGGGGAGGCAGCAGGACGAAGG + Intergenic
939045617 2:137246155-137246177 GAAGAGATCCAGGAGGAGGATGG + Intronic
939560259 2:143723331-143723353 GAGGGGCTGAAGGAGGAGGCTGG + Intronic
939983219 2:148805651-148805673 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
939991247 2:148877727-148877749 AAGGGGATGGGGGAGGAGGGAGG - Intronic
940037302 2:149324266-149324288 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
940316337 2:152331209-152331231 TAATTGATTCAGGAGGAGGAGGG + Intergenic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941343364 2:164336149-164336171 TAGGCCATGCATGTGGAGGAGGG + Intergenic
942654029 2:178195415-178195437 CCGGGGATGCTGGGGGAGGAGGG + Intronic
942816700 2:180060867-180060889 TAGGGGTTGCAGGAGGATGAAGG - Intergenic
943445295 2:187977870-187977892 CTGGTGTTGCAGGAGGAGGAAGG + Intergenic
943772399 2:191732682-191732704 TGGGGGATGAGGGAGAAGGAAGG + Intergenic
943805630 2:192121447-192121469 GAGGGGAAGGAGGAGGTGGAAGG + Intronic
943831571 2:192470817-192470839 TAGGGGAGGCAAGATGATGATGG + Intergenic
943890257 2:193277272-193277294 GAGGGGGAGGAGGAGGAGGAAGG - Intergenic
944499163 2:200340572-200340594 GAGGGGGTGCAGCAGGAGGTGGG + Intronic
944818200 2:203401275-203401297 GAGGAGATGAAGGTGGAGGAGGG - Intronic
944822050 2:203441032-203441054 TTGGGGGTGGAGGAGGGGGAGGG + Exonic
945033633 2:205686218-205686240 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
945225951 2:207530655-207530677 TGGGGGATGGAGGAGGAAGAAGG + Intronic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946085041 2:217162433-217162455 AAAGGGAAGCAGGAGGATGAAGG + Intergenic
946189980 2:218003032-218003054 TGGGGGGAGGAGGAGGAGGAGGG - Intergenic
946922141 2:224591264-224591286 TAGGGGAGGTAGGAGGACCAGGG - Intergenic
946971759 2:225101108-225101130 TTGGTGATGGAAGAGGAGGAAGG + Intergenic
947691400 2:232139934-232139956 TAGGGCATGAGGGAGAAGGATGG + Intronic
948091926 2:235302165-235302187 AAGGGGAGGAGGGAGGAGGAGGG - Intergenic
948384999 2:237575706-237575728 CAGGCCCTGCAGGAGGAGGAAGG - Intronic
948493219 2:238327226-238327248 TGGGTGAGGCTGGAGGAGGAAGG - Intronic
1168761862 20:354803-354825 GAAGGGGTGCAGGATGAGGAGGG - Exonic
1168866739 20:1093001-1093023 TAGGGCAGGAAGGTGGAGGAAGG + Intergenic
1168876099 20:1173341-1173363 TTGGGGATCAGGGAGGAGGAGGG - Intronic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1169074119 20:2751028-2751050 AAGGGGAAGGAGGAGGAGAAGGG + Intronic
1169081405 20:2799661-2799683 TAGAGGAGGCAAGTGGAGGAGGG - Intronic
1169210868 20:3765707-3765729 AGGGGGAGGCAGGAGGAGGGAGG - Intronic
1169276216 20:4235339-4235361 TAGAGGATGCAAGAGGATGCGGG - Intronic
1169651662 20:7874925-7874947 TAGGGGATTCAAGGGGAGGTGGG + Intergenic
1170271407 20:14531095-14531117 CAGGGAAGGTAGGAGGAGGAGGG + Intronic
1170418084 20:16165600-16165622 TAGAGGATGCATCAGGAGTAAGG + Intergenic
1170717470 20:18844414-18844436 TAGGGGATGACCAAGGAGGAGGG + Intergenic
1170823238 20:19771865-19771887 AAGAGGAGGCAGGAGGAGGCAGG - Intergenic
1171085830 20:22237438-22237460 AAGGGGAAGGAGGAGGAGCAGGG - Intergenic
1171364770 20:24616392-24616414 GGGAGGATGCAGGTGGAGGAGGG - Intronic
1171796204 20:29568226-29568248 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1171852032 20:30315941-30315963 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1172151943 20:32796896-32796918 TAGAGGAGGCAAGGGGAGGAAGG - Intronic
1172286668 20:33745476-33745498 TAGGGGATGCCAGACGGGGATGG + Intronic
1172791767 20:37510774-37510796 GAGGGGAAGAAGGAGGTGGAGGG - Intronic
1172984843 20:38976758-38976780 TAGGGGCTGCAGAGGGAAGAGGG - Intronic
1173034338 20:39394359-39394381 GAAGATATGCAGGAGGAGGAGGG + Intergenic
1173112287 20:40203229-40203251 GAGGGGAAGAAGGAAGAGGAGGG + Intergenic
1173297119 20:41769574-41769596 TAAGGGAGGCAGGGGAAGGAAGG + Intergenic
1173323015 20:42006449-42006471 TAAGGGGTGGAGGAGCAGGATGG - Intergenic
1173660401 20:44729318-44729340 TGGGAGATGCAGGACAAGGAAGG + Intergenic
1174576468 20:51541443-51541465 TAGAGGGAGGAGGAGGAGGAGGG - Intronic
1174983912 20:55428201-55428223 GAGGGGAGACAGGAAGAGGAAGG + Intergenic
1175605906 20:60312011-60312033 AAGGGGAGGCAGCAGGAGGCAGG + Intergenic
1175868718 20:62196563-62196585 TTGGGGCTGAAGCAGGAGGATGG + Intronic
1176006021 20:62862667-62862689 TAGTGGCTGCAGGCGGGGGAGGG - Intergenic
1176312189 21:5157980-5158002 TAGGGGAGGCGGGTGGGGGAGGG - Intergenic
1176614896 21:9018609-9018631 TGGCAGATACAGGAGGAGGATGG + Intergenic
1176710314 21:10145262-10145284 TGGCAGATACAGGAGGAGGATGG - Intergenic
1177282140 21:18994472-18994494 AAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1177341452 21:19806416-19806438 TAGGGAATGATGGAGGAAGATGG - Intergenic
1177355440 21:19999874-19999896 AAGGGGCTGCATGAGGAGGGTGG + Intergenic
1177758261 21:25373584-25373606 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1178068030 21:28928113-28928135 TAGGGAAAGAAGGAGGAGAATGG + Intergenic
1178272001 21:31199400-31199422 GAGGGGATGCAGGAGATGGTGGG - Intronic
1178506930 21:33170105-33170127 TAGGGGATACTGTAGCAGGAGGG - Intronic
1178626739 21:34224761-34224783 TAGGAGCTGGAGGAAGAGGAGGG + Intergenic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1178691869 21:34756477-34756499 TATGGGAAGCAGCAGGATGAAGG - Intergenic
1178929419 21:36804626-36804648 TGGGGATGGCAGGAGGAGGAAGG - Intronic
1179125509 21:38587303-38587325 AAGGGGATGGGGGAGGGGGACGG + Intronic
1179131187 21:38638803-38638825 AAGGGGATGTGGGAGGAGGAGGG - Intronic
1179844859 21:44104050-44104072 TAGGGGAGGCGGGTGGGGGAGGG + Exonic
1179893176 21:44347918-44347940 TAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1180127576 21:45802700-45802722 TGAGGGAGGCAGGAGCAGGAGGG + Intronic
1180199924 21:46218066-46218088 TAGGGGAGGCAGGAAGTGAAGGG - Intronic
1180294393 22:10872414-10872436 TGGCAGATACAGGAGGAGGATGG - Intergenic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180497199 22:15901828-15901850 TGGCAGATACAGGAGGAGGATGG - Intergenic
1180729765 22:17972644-17972666 TTGGGGCAGCAGGAGAAGGAAGG + Intronic
1180953774 22:19732208-19732230 TGGAGGCTGCAGGGGGAGGATGG + Intergenic
1180955163 22:19738221-19738243 AAGGGGAGACTGGAGGAGGAGGG - Intergenic
1181318816 22:21989096-21989118 AAGTGGGTGCAGCAGGAGGAAGG + Intergenic
1181546516 22:23605515-23605537 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1181554127 22:23657865-23657887 GAGGAGGTGGAGGAGGAGGAGGG - Intergenic
1181618004 22:24068188-24068210 TTGGGGAAGCAGGAGGGAGAAGG + Intronic
1181711865 22:24696188-24696210 AAGGGGGTGGAGGAGGAGAAAGG - Intergenic
1181812866 22:25414798-25414820 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1181979086 22:26753276-26753298 TTGGGGATTCAGGAGGAGCCTGG + Intergenic
1182363547 22:29762777-29762799 GACGGGATACAGGAGGGGGATGG - Intronic
1182491613 22:30676003-30676025 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1182658794 22:31910509-31910531 TGGAGGATGATGGAGGAGGAAGG - Intergenic
1182754589 22:32668547-32668569 GAGTGGAGGAAGGAGGAGGAAGG - Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183263781 22:36813380-36813402 TAGGGGATCCAGGAGGATTTGGG - Intronic
1183354933 22:37353161-37353183 GACTGGATGCAAGAGGAGGAAGG - Intergenic
1183442266 22:37830026-37830048 GAGGGGAGGCAGGGGCAGGAGGG - Intergenic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1184248838 22:43249013-43249035 CAGGGGGTGCTGGTGGAGGAAGG + Intronic
1184342295 22:43892519-43892541 TAGGGGAGGAGGGAGGAGGTGGG - Intergenic
1184402346 22:44281326-44281348 TAGGGAGTCCAGCAGGAGGACGG + Intronic
1184420981 22:44382788-44382810 CAGGGGGTGGAGGAGCAGGAGGG - Intergenic
1184455432 22:44607278-44607300 ATGGGGATGGAGGAGGAGGAGGG + Intergenic
1184652596 22:45925962-45925984 CAGGGGAGGGAGGAGGGGGAGGG - Intronic
1184663234 22:45975179-45975201 TAGGGGTGCCAGGAGGGGGAAGG + Intronic
1185089383 22:48757251-48757273 GATGGGAAGGAGGAGGAGGAGGG + Intronic
1185089412 22:48757352-48757374 GATGGGAAGGAGGAGGAGGAGGG + Intronic
1185187645 22:49412180-49412202 GAGGGAGTGGAGGAGGAGGAGGG + Intergenic
1185272579 22:49935806-49935828 TGGGGGGTCCAGGAGGAGCAGGG + Intergenic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
1185384648 22:50526200-50526222 AAGGGGATGGCGGAGGCGGAAGG + Intronic
949266361 3:2161208-2161230 AAGGGGATGCTGGAGGATAAGGG + Intronic
949465387 3:4338161-4338183 AAGGTGAAGCAGGCGGAGGATGG + Intronic
949494856 3:4621846-4621868 TTGGAGTTGCAGGAGGAGAAAGG - Intronic
950221912 3:11202547-11202569 TAGGGGATGGAGGAGGGTGGGGG - Intronic
950472234 3:13193464-13193486 TGGGGGATGAAGGATGTGGACGG + Intergenic
950540125 3:13607428-13607450 TAGGAGGGGGAGGAGGAGGAGGG + Intronic
951149964 3:19277197-19277219 AAGGGGAGGCAGGGGGATGAAGG + Intronic
951741061 3:25923841-25923863 TAGAGGATGAAGAAGGACGAAGG + Intergenic
952861934 3:37820150-37820172 TGGGGGAAGCAGGACAAGGAAGG + Exonic
953023524 3:39131140-39131162 TGGGGGCTGAAGGAGGAGGAAGG + Intronic
953365420 3:42340458-42340480 GAGGGGGAGGAGGAGGAGGAGGG + Intergenic
953383561 3:42492193-42492215 TAGGGGAGGAGGGATGAGGAAGG - Intronic
953563583 3:44013055-44013077 TTGGTGACGGAGGAGGAGGAAGG + Intergenic
953707749 3:45244032-45244054 GAGGAGATGCTGGATGAGGAGGG - Intergenic
953978210 3:47398668-47398690 TGGGGGCTGCAGTGGGAGGATGG - Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954411854 3:50374334-50374356 TAGGGGGAGGAGGAGGGGGAAGG + Intronic
954432945 3:50480907-50480929 AAGGGGAGGAAGGGGGAGGAAGG + Intronic
954539501 3:51384464-51384486 CCGGGGAGGCAGGAGGAGGCTGG + Intergenic
954852754 3:53617310-53617332 GAGGGGAGGCAGGAGGAGGTAGG + Intronic
954976405 3:54699277-54699299 CATGGGATGCTGGAGGAGCAAGG + Intronic
955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG + Intronic
955953995 3:64269234-64269256 TAGTGGTGGCAGGCGGAGGAGGG + Intronic
956223755 3:66933369-66933391 AAGGGACTGCAGGGGGAGGATGG - Intergenic
956874146 3:73445334-73445356 TAGGAGAAGCAGGAGTTGGATGG + Intronic
957245111 3:77706516-77706538 GGGGGGCTGGAGGAGGAGGATGG + Intergenic
957810597 3:85215939-85215961 TAGAGAATGAGGGAGGAGGAGGG + Intronic
958182991 3:90083923-90083945 AGGGGGATACAAGAGGAGGATGG - Intergenic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959429304 3:106232919-106232941 TAATGTATGCAGCAGGAGGAAGG + Intergenic
959584725 3:108015422-108015444 CAGGGCATGCAGGAGGGGCATGG - Intergenic
960694879 3:120386354-120386376 TGGGGGGTTCAGGAGAAGGATGG + Intergenic
960950123 3:122993775-122993797 TGGGGGAGGCAGGAGCGGGAGGG - Intronic
961111236 3:124285028-124285050 TAGGGGTAGCAGGAGAAGGAGGG + Intronic
961168722 3:124780778-124780800 GAGGGGAAGAGGGAGGAGGAGGG - Intronic
961302714 3:125932595-125932617 TGGGGGATGGTGGAGGGGGAGGG - Intronic
961428561 3:126864348-126864370 GTGGTGATGAAGGAGGAGGAGGG - Intronic
961504351 3:127360451-127360473 TAGGGGTGGCAGGAGGCGGTGGG - Intergenic
961555144 3:127692146-127692168 TGGGGGATGCAGGCAGGGGAAGG - Exonic
961725188 3:128923535-128923557 TAAGGGCTGCAGAAGGATGAAGG - Intronic
961745152 3:129059760-129059782 TTGGCCATGCAGGAGGAGGAAGG + Intergenic
961885351 3:130093193-130093215 TGGGGGATGGTGGAGGGGGAGGG + Intronic
961940938 3:130636896-130636918 GAGGGGAGGAAGGGGGAGGAAGG - Intronic
962072168 3:132044614-132044636 GAGGGGATGAAGGGGGAGGGAGG + Intronic
962425620 3:135266786-135266808 TAGTGTATGCTGGAGGAGGAAGG - Intergenic
962636998 3:137341360-137341382 CAGGGGATGCAGGGGGAAAAAGG - Intergenic
962932087 3:140048070-140048092 GAGGGGAGAAAGGAGGAGGAAGG + Intronic
963057929 3:141202389-141202411 TAGGACATGCAGGAGGAGGAAGG + Intergenic
963224030 3:142842796-142842818 TAAGGGATACAAGAAGAGGAAGG - Intronic
963320670 3:143806070-143806092 TAGGGGATGTGGGAAGAGGTGGG - Intronic
963774382 3:149423265-149423287 TGGGGGATGGTGGAGGATGAGGG + Intergenic
964537935 3:157746096-157746118 TAGGGTGAGAAGGAGGAGGAAGG + Intergenic
965067130 3:163864339-163864361 ATGGGGATCCAGGAGGATGAGGG - Intergenic
965119350 3:164531620-164531642 TTGGGGAGGCAGTAGGAGGCAGG - Intergenic
965247493 3:166292238-166292260 TAGGGGATGTAGCAGGAAAAAGG + Intergenic
965885276 3:173437858-173437880 TAGGGAAGGCAGGATCAGGAAGG - Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966908476 3:184544503-184544525 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
966908524 3:184544619-184544641 GAGGGGGAGAAGGAGGAGGAGGG - Intronic
966908531 3:184544637-184544659 TAGGAGGGGGAGGAGGAGGAGGG - Intronic
966974797 3:185074302-185074324 ATGGGCATGCTGGAGGAGGATGG - Intergenic
966981353 3:185139125-185139147 GAGGGGGAGCGGGAGGAGGAAGG + Intronic
967210199 3:187161764-187161786 TAGGGGAAGCAGAGGTAGGAAGG - Intronic
968585147 4:1412865-1412887 GAGGCGGTGCAGGAAGAGGATGG + Intergenic
968615064 4:1573993-1574015 TTGGGGATGCAGGAAGAGCTGGG - Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968689859 4:1984825-1984847 CTGGGGATGTAGGAGGAGGCGGG + Exonic
968741393 4:2333286-2333308 TAGGGGAGGCCAGAGGAGGGAGG - Intronic
969391514 4:6894584-6894606 TAGGGGAGGGAGGAGGAGACAGG + Intergenic
969454721 4:7294717-7294739 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
969454792 4:7294899-7294921 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
969489092 4:7488658-7488680 TGGGGGATCCATGAGGTGGAGGG + Intronic
969568816 4:7996026-7996048 CTGGGCATGAAGGAGGAGGAAGG - Intronic
969621035 4:8279000-8279022 GAAGGGATGGAGGGGGAGGAGGG - Intronic
969861512 4:10039574-10039596 GTGGGGATCCAGGAGAAGGAAGG - Intronic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970447911 4:16139616-16139638 TCCAGGATGCATGAGGAGGATGG + Intergenic
970530262 4:16974640-16974662 TATGGGATGATGGAGGTGGAGGG - Intergenic
971061479 4:22976842-22976864 TAGAATATACAGGAGGAGGAAGG + Intergenic
971558282 4:28040838-28040860 TTGGGGATGTGGGAGGAGGATGG + Intergenic
971570946 4:28210010-28210032 GAGGGGAAGGAGGAGGAAGAGGG - Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972847633 4:43008964-43008986 TAAGAGGTGCAGGAGAAGGAAGG - Intronic
973160975 4:47016046-47016068 TAGAGGATGCAGCAGGTGAAAGG + Intronic
973530997 4:51836744-51836766 TGGGGGAGGGAAGAGGAGGATGG - Intergenic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
974145541 4:57943120-57943142 ATGGGGATGAAGGAGGAGAAGGG + Intergenic
974229253 4:59088889-59088911 GAGGGGGAGGAGGAGGAGGAAGG - Intergenic
975538799 4:75481534-75481556 TAGGGGATGGATGAGTGGGAAGG - Exonic
976184117 4:82429024-82429046 GAGGGGTTGGAGGAGGAGGGCGG - Intronic
976647731 4:87402749-87402771 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
976802347 4:89006798-89006820 CAGGGGATGGTGCAGGAGGAAGG + Intronic
977628469 4:99215210-99215232 TAGGGGATGTAGGATGGAGAAGG + Intronic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978838602 4:113183221-113183243 GAGGGGATGGAGGTGGAGGAGGG + Intronic
979817102 4:125122641-125122663 TTGGGGATGCAGGAAGATGAAGG + Intergenic
980954250 4:139412255-139412277 TAGGGGATGAAGGGGGAAAAAGG - Intronic
981033730 4:140151182-140151204 GAGTGGCTGGAGGAGGAGGAAGG + Intronic
981901589 4:149871402-149871424 TAGGGGATCCAGGAATAGGTTGG - Intergenic
982117750 4:152112260-152112282 AATGGGGTGGAGGAGGAGGAGGG - Intergenic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
982348115 4:154384334-154384356 CAGGTGGTGCATGAGGAGGAGGG - Intronic
982666461 4:158270110-158270132 TTGGGGATGTAGGAGTAGAAAGG - Intergenic
982913539 4:161175905-161175927 AAGTGGATGAAGGGGGAGGAGGG + Intergenic
983137944 4:164107937-164107959 AAGAGGATGGAGGAGGTGGAGGG - Intronic
984637885 4:182133019-182133041 CAGGCGAGTCAGGAGGAGGAGGG + Intergenic
984938383 4:184909721-184909743 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
984985960 4:185329704-185329726 GAGAGGATGAGGGAGGAGGAGGG + Intronic
985619245 5:945191-945213 CAGAGGAGGCAGGAGGAGCATGG - Intergenic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
985898072 5:2762239-2762261 GAGGGGAGGCAGCAGGAGGCTGG + Intergenic
986210347 5:5665688-5665710 GAGGAGCTGCAGGAGGTGGAGGG + Intergenic
986221994 5:5776354-5776376 CCTGGGATGCAGGAGGAGGGAGG + Intergenic
986512530 5:8523395-8523417 TAGGGTCTGCAGGATAAGGAAGG + Intergenic
987133295 5:14879113-14879135 TTAGGGATACAGGAGAAGGAGGG - Intergenic
987616169 5:20276939-20276961 AAGGGGAGGAAGGAGTAGGAAGG + Intronic
987826864 5:23042430-23042452 TAGGGGATGGTGTGGGAGGAGGG - Intergenic
987876810 5:23690479-23690501 TCGGGGTTGCAGAAGGATGAGGG - Intergenic
987956494 5:24748216-24748238 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
988208949 5:28177614-28177636 TGGGAGAGGCATGAGGAGGAGGG - Intergenic
988297839 5:29390008-29390030 AAGGTCATGGAGGAGGAGGAGGG - Intergenic
988456867 5:31394514-31394536 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
989201903 5:38772295-38772317 TAGGCGAGGCAGGTGGAGAATGG + Intergenic
989693472 5:44171734-44171756 AAGGGCATTCAGGAGCAGGAGGG - Intergenic
989983164 5:50666903-50666925 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
990119443 5:52431937-52431959 AAGGGGATCCTGGAGGATGAGGG - Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
991637663 5:68722493-68722515 TAATGCATGGAGGAGGAGGAAGG + Intergenic
992093648 5:73340611-73340633 TGGGGGAGGCAGAAGGGGGATGG - Intergenic
992187677 5:74259881-74259903 TAGGGAATGGAGGTGGAGGAGGG - Intergenic
992222117 5:74583387-74583409 CATAGGATGCAGGAAGAGGAAGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994165026 5:96599241-96599263 TAGGGGGTGAAAGAGAAGGAGGG + Intronic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994869685 5:105331629-105331651 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
995011902 5:107265686-107265708 TTGGGGATGGGTGAGGAGGAGGG - Intergenic
995069668 5:107904925-107904947 GGGGTGAAGCAGGAGGAGGAGGG + Intronic
995616392 5:113969057-113969079 TGGGGAATGAAGGAGAAGGATGG + Intergenic
996314746 5:122149141-122149163 TAGTGAATGCAAGCGGAGGAAGG + Intronic
996397547 5:123028383-123028405 TGGGCGTTGCAGGAGGAAGACGG - Intronic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996487699 5:124056256-124056278 TTGGGGATGGAGTGGGAGGAAGG + Intergenic
996526178 5:124482234-124482256 TAGGGGTTGCTGAAGGTGGATGG + Intergenic
996753746 5:126915129-126915151 AAGGGGCTGCAAGAGAAGGAGGG + Exonic
997366356 5:133327671-133327693 TAAGGGCTTCAGGGGGAGGAGGG + Intronic
997467713 5:134099370-134099392 TTGGGGATGCTAGAGGAGGCTGG + Intergenic
997756353 5:136403162-136403184 GAGGGGAGGCTGGAGGTGGATGG + Intergenic
997791442 5:136766002-136766024 AAGGGGAGGAAGCAGGAGGATGG - Intergenic
998028014 5:138837501-138837523 GAGGGGAGGGAGGAGGGGGAGGG - Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998407579 5:141882816-141882838 GAGGGGAGACAGGAGCAGGAAGG + Intergenic
998484089 5:142486609-142486631 TAGTGAATGTGGGAGGAGGAGGG - Intergenic
998534006 5:142912397-142912419 TTGGGGATGTACTAGGAGGAGGG + Intronic
998604040 5:143615506-143615528 AGGGGGAGGGAGGAGGAGGAAGG - Intergenic
999040007 5:148398516-148398538 TAGAGTTTGCAGGAGCAGGATGG + Intronic
999133155 5:149299745-149299767 CAGGGGCTGCCGCAGGAGGAAGG + Intronic
999381443 5:151124167-151124189 TAGAGTCTGCAGGATGAGGAAGG - Intronic
999553897 5:152720471-152720493 GAGGGGATCCCGGAGGAGAATGG - Intergenic
999687574 5:154116730-154116752 TACTGGATGCTAGAGGAGGAAGG - Intronic
1000091068 5:157930100-157930122 GAGGGGAAGAAGGGGGAGGAAGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000607142 5:163337527-163337549 TAGGTGTTGGAGGAGCAGGAGGG - Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1000980706 5:167813683-167813705 TAGGGGATGCAGTGAGAGGGAGG - Intronic
1001056448 5:168454017-168454039 GAGGAGGTGGAGGAGGAGGAGGG + Exonic
1001132891 5:169079491-169079513 GGGGGGAGGGAGGAGGAGGAAGG + Intronic
1001245614 5:170104216-170104238 TAGGGCATGCAGGAAGTGGGAGG + Intergenic
1001433805 5:171683904-171683926 TAGGGCAAACAGGAGGAGGTGGG - Intergenic
1001600099 5:172923072-172923094 TAGGAGGAGGAGGAGGAGGAGGG + Intronic
1001706044 5:173741758-173741780 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1001805677 5:174583844-174583866 TAGAGGCTGCAGGAACAGGAGGG - Intergenic
1001994342 5:176143450-176143472 TAAGGGTTGCAGAAGGATGAAGG + Intergenic
1002170444 5:177371507-177371529 TGGGGGACGCTGGAGGGGGATGG - Exonic
1002430727 5:179202424-179202446 TAGGAGATGGAGAAGGAAGAAGG - Intronic
1002900676 6:1407356-1407378 TTGTGGATGCTGGAGGAGGGTGG + Intergenic
1002929845 6:1625459-1625481 TGGGGAAAGCGGGAGGAGGAAGG - Intronic
1003020431 6:2504832-2504854 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003020438 6:2504868-2504890 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003527741 6:6911934-6911956 TAGATGATGCAGGAAAAGGAGGG - Intergenic
1003599374 6:7503218-7503240 CATGGGATGCAGGAGAAGGGAGG - Intergenic
1004377890 6:15106476-15106498 GTAGGGATTCAGGAGGAGGAGGG + Intergenic
1004485623 6:16063644-16063666 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1004537397 6:16515807-16515829 AAGCGGATGCAGGAGGGGGATGG + Intronic
1004618812 6:17315438-17315460 TAAGGGAAGCAGGGGGTGGAAGG + Intergenic
1004757943 6:18633605-18633627 GAGGGGAGGGAGTAGGAGGAGGG + Intergenic
1004973590 6:20939253-20939275 TAGTAAATGCAGCAGGAGGAAGG - Intronic
1005039531 6:21588499-21588521 CAGGGGATGGGGTAGGAGGACGG + Intergenic
1005782455 6:29206937-29206959 TAGGGGATGGGGGAGGGGAATGG - Intergenic
1005921592 6:30406672-30406694 TAAGGGTTGCAGAAGGATGAAGG - Intergenic
1006179703 6:32147533-32147555 TAGGAGATGTGGGAGGAGGGTGG - Intergenic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006510634 6:34519318-34519340 TTGAGGAGGAAGGAGGAGGATGG - Intronic
1006520627 6:34568997-34569019 TAGTGGAAGCAGGAACAGGACGG + Intergenic
1006520856 6:34570342-34570364 GAGGGGGTGAAGGAGGAGGGTGG - Intergenic
1006735067 6:36267710-36267732 AAGGGTAAGCAGGCGGAGGAGGG - Intronic
1006808331 6:36803349-36803371 TTAGAGATGCAGGAGGATGATGG - Intronic
1006980351 6:38142687-38142709 TAGAGGCTGGAGGAGGTGGAGGG + Intronic
1007078519 6:39083018-39083040 TAGGTGGTGCATGAGGAGGGAGG - Intronic
1007362992 6:41371984-41372006 TAGGAGATGGGGGAGGAGGATGG + Intergenic
1007381247 6:41491661-41491683 AAGGGGATGCAGGAAGACCAGGG + Intergenic
1007395497 6:41575541-41575563 TAGGGGGTGTAGGGGGAGGAAGG + Intronic
1007692108 6:43709129-43709151 GAGGGGAAGGAGGGGGAGGAGGG - Intergenic
1007765117 6:44155334-44155356 TAGGGGATGCATGAGGGGGGAGG + Exonic
1007994843 6:46295834-46295856 TTGGGGAAGCAGCAGGAGGGAGG + Intronic
1008029744 6:46680951-46680973 TAGGGGAAGCAGTGGGAGAAAGG - Intergenic
1008779781 6:55089650-55089672 AAGAGGATGGAGGAGGAAGAAGG - Intergenic
1008863216 6:56176864-56176886 AAGGGGAGGAAAGAGGAGGAAGG + Intronic
1008863233 6:56176903-56176925 AAGGGGAGGAAGGGGGAGGAAGG + Intronic
1009593666 6:65708583-65708605 GAAGGGAAGGAGGAGGAGGAAGG - Intergenic
1009833237 6:68966415-68966437 TGGGTGATTCAGCAGGAGGAGGG - Intronic
1010445211 6:75941924-75941946 TAGGGGAGGCAGGAGTGGGTAGG + Intronic
1010686264 6:78858065-78858087 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1011140627 6:84151681-84151703 TTGGGGATGGAGAAGGAAGAAGG + Intronic
1011360337 6:86517356-86517378 AAGGGGATGCATTATGAGGAGGG - Intergenic
1011722837 6:90176769-90176791 TGGAGGAGGCAGGAGCAGGAGGG - Intronic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1012032780 6:94093800-94093822 TAGGAGATGGAGGATGTGGAAGG - Intergenic
1012611150 6:101222624-101222646 GAAGGGAAGCAGGAGGGGGAGGG - Intergenic
1013926037 6:115473689-115473711 CAGGGGTGGGAGGAGGAGGAAGG + Intergenic
1014242439 6:119032616-119032638 GAGGGGGAGGAGGAGGAGGAAGG + Intronic
1014792260 6:125686758-125686780 TTGGGGATTCAGGGGGAAGAGGG - Intergenic
1014813623 6:125911588-125911610 TAGGGGTTGCAGAAGGATGAAGG + Intronic
1015113505 6:129619630-129619652 AAGGGGATGGGGGAGGGGGAGGG + Intronic
1015153362 6:130063319-130063341 TAGAAGCTGAAGGAGGAGGAGGG + Intronic
1015209341 6:130678967-130678989 GAAGGGATGTAGGAAGAGGAAGG + Intergenic
1015389922 6:132670105-132670127 GAGGGGAGGAAGGAAGAGGAGGG + Intergenic
1015568839 6:134601370-134601392 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1015867812 6:137745085-137745107 AAGGGGCTGCAAGAGGAGGGAGG - Intergenic
1015916501 6:138222858-138222880 TGGGGGAGGGAGGAGGATGAGGG - Intronic
1016120507 6:140337437-140337459 CAGGTGATTCTGGAGGAGGAAGG - Intergenic
1016241425 6:141935722-141935744 GAGGGGATGCAGATGGAGGTGGG + Intergenic
1016486812 6:144549639-144549661 TGGGGGAGCCAGGATGAGGAAGG + Intronic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016993998 6:149948113-149948135 TGGGGTGTGCAGGAGGATGATGG - Intronic
1017294287 6:152776152-152776174 CAGGGGGTGCAGTGGGAGGAGGG + Intergenic
1018109368 6:160520347-160520369 GAGGGGATGCGGGGGGAGGGGGG + Intergenic
1018452121 6:163919099-163919121 GAGGGGATCCAGCAGCAGGAAGG + Intergenic
1018687746 6:166317017-166317039 TAGGGGCTGCAGAAGGATGAAGG - Intergenic
1018691194 6:166345460-166345482 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1019320738 7:414283-414305 GAGGGGAAGGAGGAGAAGGAGGG - Intergenic
1019390612 7:784506-784528 TAGCTGAGGCAGGAAGAGGATGG - Intronic
1019508355 7:1404804-1404826 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508370 7:1404838-1404860 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508385 7:1404872-1404894 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508400 7:1404906-1404928 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019637178 7:2082160-2082182 GAAGGGAGGCAGGAGGGGGAGGG + Intronic
1019646965 7:2136027-2136049 TAGGGGCTCTAGGAGAAGGAAGG - Intronic
1019788878 7:2997424-2997446 CAGGGGAGGCAGGGCGAGGATGG + Intronic
1019880607 7:3857279-3857301 AAGGGGAAGGAGGAGGAGAAAGG + Intronic
1019954977 7:4406074-4406096 TAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1020254165 7:6492773-6492795 TAGAGGAGGAAGGAGGAGGAGGG + Intergenic
1020318822 7:6925743-6925765 TGGGGGATGGTGGAGGGGGAGGG + Intergenic
1020508297 7:9020414-9020436 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1020905555 7:14060183-14060205 TAGGGGAGGCAGGAGAAGTTTGG + Intergenic
1021100722 7:16584469-16584491 TAGGGGATGTAGGAAGAATAGGG + Intergenic
1021685538 7:23182159-23182181 CTAGGGGTGCAGGAGGAGGACGG + Exonic
1022321598 7:29293265-29293287 TCGAGGATGCAGGAGGGAGAAGG - Intronic
1022437161 7:30399310-30399332 CAGAGGCTGGAGGAGGAGGAGGG + Intronic
1022454352 7:30545553-30545575 TAGGGGTTGCAGAAGGATGAAGG - Intronic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1023827580 7:44019714-44019736 TGAGGGATGCAGAAGGAGGCAGG + Intergenic
1023934904 7:44732788-44732810 TACCAGATGCAGGAGGAGGCAGG + Intergenic
1024019547 7:45353358-45353380 CAGGGGAGGGAAGAGGAGGAAGG + Intergenic
1024499731 7:50092328-50092350 TAGGGGATAGGGGAGGAGAAAGG - Intronic
1025111037 7:56216411-56216433 GAAGGGTTGCAGAAGGAGGAGGG + Intergenic
1025198743 7:56949553-56949575 AAGGGGAGGGAGGAGGAGGGGGG - Intergenic
1025228329 7:57182211-57182233 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1026136025 7:67661555-67661577 CAGGTGATGGAGGAGAAGGATGG - Intergenic
1026148623 7:67769813-67769835 GAGGAGGTGGAGGAGGAGGAGGG - Intergenic
1026159095 7:67852960-67852982 GAGGGGATGCTGGAGGGAGAAGG + Intergenic
1026191930 7:68136553-68136575 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
1026290999 7:69006105-69006127 TAGGGGGTTTAGGAGTAGGAAGG - Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026806125 7:73430450-73430472 AAGGGGATGGAGGGGGAGGAGGG - Intergenic
1026806137 7:73430474-73430496 AAGGGGAGGGAGGGGGAGGAGGG - Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027448615 7:78303407-78303429 CAGATGATTCAGGAGGAGGAGGG - Intronic
1027601402 7:80245520-80245542 TACGGTCTTCAGGAGGAGGAAGG - Intergenic
1027878285 7:83799898-83799920 GAGGGGAGGCAGGAGGAATATGG + Intergenic
1028193362 7:87876788-87876810 AAGGGACTGCAGGCGGAGGAGGG - Intronic
1028831243 7:95328493-95328515 TAAAGGAGGCAGGAGGAGCAGGG + Intergenic
1029412873 7:100426927-100426949 AAGGGGAGGGAGGAGGGGGAGGG - Intronic
1029422104 7:100477195-100477217 GAGGGGGGGGAGGAGGAGGAAGG + Intronic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029652962 7:101906327-101906349 GAGGTGAGGCAGGAGGAGCAGGG + Intronic
1029738754 7:102479483-102479505 TGAGGGATGCAGAAGGAGGCAGG + Intergenic
1029755880 7:102573140-102573162 TGAGGGATGCAGAAGGAGGCAGG + Intronic
1029773822 7:102672213-102672235 TGAGGGATGCAGAAGGAGGCAGG + Intergenic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030172393 7:106616486-106616508 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1031196424 7:118620260-118620282 GAGGAGATGCTGGAGGAGGCTGG - Intergenic
1031197102 7:118628933-118628955 GAGGAGATGCTGGAGGAGGCTGG + Intergenic
1031313293 7:120226925-120226947 TAGGGGAGCCTAGAGGAGGAAGG - Intergenic
1031430259 7:121659269-121659291 TGGGGGCTACAAGAGGAGGAAGG - Intergenic
1031597305 7:123662861-123662883 GAGGGGGAGGAGGAGGAGGAGGG - Exonic
1031984184 7:128152254-128152276 TTGGGGTTGAAGGAGGAGGAAGG - Intergenic
1032071396 7:128809558-128809580 AGGAGGATGCAGGAGGAGCAGGG + Exonic
1032489645 7:132314549-132314571 TAGGGAAGGGAGGAAGAGGAAGG + Intronic
1032509996 7:132465092-132465114 TGGGGGATGCAAGTGGTGGAGGG - Intronic
1033041713 7:137925197-137925219 GAGGGGAAGCAGGAGGCAGAGGG + Intronic
1033086317 7:138345267-138345289 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1033116788 7:138632574-138632596 TGGGGGATGGAGAAGGTGGAGGG + Intronic
1033155218 7:138950985-138951007 TTGGGGATGAAGGAGTAGGTAGG - Intronic
1033266152 7:139888901-139888923 GAAGGGGTGCAGGGGGAGGATGG + Intronic
1033327368 7:140390701-140390723 TGGGGGATGGAGGAGAAGGGTGG - Intronic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033586910 7:142780807-142780829 AAGCGGAGACAGGAGGAGGATGG - Intergenic
1033598789 7:142874648-142874670 TAGGTGATGCTGGGGGAGCAGGG + Exonic
1033807488 7:144971378-144971400 GTGGTGATGGAGGAGGAGGATGG + Intergenic
1034271145 7:149803916-149803938 CAGGGGATGAAGGATGAAGAAGG + Intergenic
1034277269 7:149829401-149829423 AGGGGGACACAGGAGGAGGAGGG - Intergenic
1034411704 7:150945546-150945568 GAGGCCATGGAGGAGGAGGAAGG + Intronic
1034491738 7:151396500-151396522 AAGGGGATGGGGGAGGAGGTAGG + Intronic
1034498352 7:151435113-151435135 GAGGGGATGCAGGGGGCAGAGGG - Intronic
1034534930 7:151720729-151720751 GAGGGGATGGAGGGGGATGAAGG + Intronic
1034720777 7:153290188-153290210 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1035293896 7:157857117-157857139 CTGGGGATGCTGGAGGGGGAGGG + Intronic
1035302185 7:157904788-157904810 TTCGCGATGCAGGAGGAGGGAGG - Intronic
1035708405 8:1695099-1695121 TGGGGGATGAAGGAGGAACATGG - Intronic
1035720314 8:1786216-1786238 GAGGGGCTGCAGGAGGAGGGGGG + Exonic
1036053095 8:5222054-5222076 TAGGGTGAGGAGGAGGAGGAAGG + Intergenic
1036204476 8:6794896-6794918 TAGGAGATGGAGGACAAGGAAGG - Intergenic
1036213799 8:6863258-6863280 TAGGGGAAGCTGGTGGAAGAGGG + Intergenic
1036627197 8:10482078-10482100 TTGGGGTTCCAGGAAGAGGATGG + Intergenic
1036748655 8:11429121-11429143 CAGGGGCTGGAGGAGGGGGATGG - Intronic
1037249037 8:16871445-16871467 TCGGGGATGGGGCAGGAGGAGGG - Intergenic
1037271152 8:17131765-17131787 TGGAGGACGCTGGAGGAGGAAGG - Intergenic
1037502202 8:19496977-19496999 GAGGGGAGGCGGGAGGGGGAGGG - Intronic
1037603962 8:20422102-20422124 TAGGGGCTGGAGGAGGTGGAGGG - Intergenic
1037658672 8:20908735-20908757 TAGGGAAGGGAGGAGGAGAAAGG - Intergenic
1037733149 8:21546116-21546138 ATGGGGATGCAGGAGAAGGAGGG + Intergenic
1037879469 8:22565878-22565900 TGGGAGACGCGGGAGGAGGAAGG + Intronic
1038238385 8:25784452-25784474 GTGGTGATGGAGGAGGAGGAAGG - Intergenic
1038304924 8:26391323-26391345 TTGTGGATGGAGGATGAGGATGG - Exonic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038576609 8:28709794-28709816 TAAGGGATGTGAGAGGAGGAGGG + Intronic
1038642916 8:29341756-29341778 TAGAGGATGAGGGAAGAGGAAGG + Intronic
1038694598 8:29795148-29795170 TAGAGGAGGAAGAAGGAGGATGG - Intergenic
1039291082 8:36095126-36095148 AGGGGGACTCAGGAGGAGGAAGG + Intergenic
1039630267 8:39103658-39103680 AAGGAGGTGCAGGAGCAGGACGG - Exonic
1039931984 8:42001015-42001037 GAGGGAAGGAAGGAGGAGGAAGG + Intronic
1040071935 8:43195648-43195670 GAGGGGCTGGAGGAGGAGGAGGG + Intronic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1040644252 8:49379944-49379966 TAGGGCATGCATGTGGGGGAGGG - Intergenic
1040684674 8:49857348-49857370 GAGTGGAGGCAGGAAGAGGAAGG + Intergenic
1041403120 8:57465440-57465462 TAAGGGTTGCAGAAGGATGAAGG - Intergenic
1041460275 8:58103773-58103795 TGTGGGAGGCAGGAGGAGAAGGG - Intronic
1041654089 8:60331144-60331166 TAGGGGATCCTACAGGAGGAAGG - Intergenic
1042358477 8:67855316-67855338 TGGGAGATGCAGTAGAAGGATGG + Intergenic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042836012 8:73079638-73079660 TTGGGGGAGAAGGAGGAGGAGGG - Intronic
1043087530 8:75853352-75853374 TAGGGGATAAAGGAGGAGGTTGG + Intergenic
1044169696 8:89034194-89034216 GAGGGGAGGAAGGAGGAGGAGGG + Intergenic
1044998096 8:97856127-97856149 TGGGGGGGGGAGGAGGAGGAGGG + Intergenic
1045747485 8:105440678-105440700 GAGAAGATGCAGGAGCAGGAGGG + Intronic
1045805673 8:106158542-106158564 TAGAGATTGCAGGAGGAGAATGG - Intergenic
1046461178 8:114538333-114538355 CAGTAGATGCAGGAAGAGGAGGG + Intergenic
1047220397 8:122914070-122914092 TTGGGGTTCCAGGAGGAGGGAGG - Intronic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1047742019 8:127814199-127814221 AAGGGGCTGGAGAAGGAGGATGG - Intergenic
1047891717 8:129319137-129319159 TGGGGGATGGAGGAAGAGGTGGG + Intergenic
1048072903 8:131040367-131040389 TTGGGGAGGCAGCCGGAGGAGGG + Exonic
1048951530 8:139500876-139500898 TTGTGAATGGAGGAGGAGGAAGG + Intergenic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049162513 8:141106275-141106297 GAGGGGATGTGGGAGGAGCAGGG + Intergenic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049386076 8:142343793-142343815 GAGGGGGAGGAGGAGGAGGAGGG + Intronic
1049442893 8:142617267-142617289 TTGGGGATGCAGGTGGGGGAAGG + Intergenic
1049451100 8:142662009-142662031 GAGGGGCTGCAGGAGGAGCAGGG + Intronic
1049554467 8:143275171-143275193 TAGGGGATGCAGGAGGAGGAGGG - Intronic
1049558182 8:143294084-143294106 GAGGGGCAGCAGGAGGAGGGGGG - Intronic
1049654779 8:143792707-143792729 CGGAAGATGCAGGAGGAGGAAGG - Exonic
1049932522 9:470558-470580 GAAAGGAAGCAGGAGGAGGAGGG + Intronic
1050610438 9:7346871-7346893 TGGAGGATGGAGGAGGAGGATGG - Intergenic
1051081381 9:13298182-13298204 TAGGGTATGAGGGATGAGGAGGG + Intergenic
1051136438 9:13927029-13927051 GAGAGGAGACAGGAGGAGGAGGG - Intergenic
1051356504 9:16244042-16244064 TAAAGGATGCAGGGGGAGGAGGG - Intronic
1052528786 9:29655743-29655765 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1052918163 9:33939854-33939876 GAGGGGGAGGAGGAGGAGGAGGG + Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053158975 9:35800481-35800503 CAGGTGATGGAGGAGGAGGCAGG + Exonic
1053233819 9:36434323-36434345 TGGGGGAAGGAGGAGGGGGAGGG + Intronic
1053624189 9:39851944-39851966 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1053647289 9:40130960-40130982 TGGCAGATACAGGAGGAGGATGG - Intergenic
1053758437 9:41332883-41332905 TGGCAGATACAGGAGGAGGATGG + Intergenic
1053789815 9:41679197-41679219 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1053880677 9:42591284-42591306 TAGTGTATGTATGAGGAGGAGGG - Intergenic
1053891992 9:42703048-42703070 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1054155325 9:61635559-61635581 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1054178155 9:61890887-61890909 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054219708 9:62398754-62398776 TAGTGTATGTATGAGGAGGAGGG - Intergenic
1054231007 9:62510419-62510441 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1054328289 9:63728916-63728938 TGGCAGATACAGGAGGAGGATGG - Intergenic
1054537290 9:66245210-66245232 TGGCAGATACAGGAGGAGGATGG + Intergenic
1054659374 9:67689937-67689959 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055446984 9:76393950-76393972 AAGGGGATGCGGGAGGAGGAAGG + Intronic
1055581437 9:77711048-77711070 GAGGGGAAGGAGGAGGGGGAGGG - Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055858644 9:80722980-80723002 TAGAGGATTCAGGAGGAGACAGG - Intergenic
1056617021 9:88177525-88177547 GAGGGCATGCAGGAGAAGGATGG + Intergenic
1056868751 9:90256474-90256496 GAGGAGGTGAAGGAGGAGGAGGG + Intergenic
1057483307 9:95462625-95462647 GAGGGGGTGGAGGAGAAGGAAGG + Intronic
1057860275 9:98635377-98635399 TAGGGGTGGCATGGGGAGGATGG + Intronic
1057964345 9:99488618-99488640 TGGGGGGTGGAGGATGAGGAGGG + Intergenic
1058069276 9:100585199-100585221 GAGGGAATGAAGAAGGAGGAGGG + Intronic
1058119612 9:101124260-101124282 TAGCGGTTGCAGAAGGATGAAGG + Intronic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058579687 9:106441415-106441437 GAGAGGAAGTAGGAGGAGGAAGG + Intergenic
1058711524 9:107683468-107683490 AAGGGGATGCAGAGGGAGAAGGG - Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058873353 9:109221229-109221251 GAGGGGAGGGAGGGGGAGGAAGG + Intronic
1059496127 9:114710885-114710907 TGGGGGTTGAGGGAGGAGGATGG - Intergenic
1059635169 9:116163288-116163310 GTGGGGATGCAGGAGGAGAGAGG + Intronic
1059801089 9:117750215-117750237 TATGGGATGCAGGAGGCATAAGG + Intergenic
1059826712 9:118038025-118038047 AAGAGGATGCAGGAGGATGGGGG + Intergenic
1060044889 9:120332120-120332142 TAGGGAAGGCAAGAGAAGGATGG - Intergenic
1060514016 9:124254718-124254740 TGAGGGATGGAGGAGGAGGAAGG + Intergenic
1060610941 9:124963881-124963903 TAGGCTGTGGAGGAGGAGGAGGG + Intronic
1060654410 9:125359203-125359225 AAGGGGATGCAGGGAGGGGAGGG - Intronic
1060960964 9:127680403-127680425 AACGGGATGCTGGAGGGGGAAGG - Intronic
1060989377 9:127839347-127839369 TAGGGGATGCCTGGGGAGGAAGG + Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061865641 9:133490692-133490714 TCAAGGCTGCAGGAGGAGGATGG + Intergenic
1061865684 9:133490830-133490852 AAGGAGGTGCTGGAGGAGGAGGG + Intergenic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1061967613 9:134025184-134025206 GAGGGGCTGGAGGAGGAGGAGGG - Intergenic
1061967640 9:134025266-134025288 GAGGGGCTGGAGGAGGAGGAGGG - Intergenic
1062245939 9:135566086-135566108 TGGGGGCTATAGGAGGAGGAAGG + Intronic
1062255774 9:135619979-135620001 TAGGGGAAGAAGGGGGAGAAGGG - Intergenic
1062469617 9:136696842-136696864 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469627 9:136696860-136696882 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469659 9:136696922-136696944 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469682 9:136696967-136696989 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469692 9:136696985-136697007 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062506965 9:136882532-136882554 TGGGGGTTGCAGGAGCAGGAAGG - Intronic
1062612996 9:137383346-137383368 CAGGGCCTGCAGGAGCAGGAGGG + Exonic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1202795078 9_KI270719v1_random:114257-114279 TGGCAGATACAGGAGGAGGATGG - Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185680010 X:1880806-1880828 TAGGGAGGGAAGGAGGAGGATGG + Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1186008457 X:5102240-5102262 TAGGGGGTGGAGGGGGAGGTGGG - Intergenic
1186072930 X:5842254-5842276 GAGGGGAAGGAGGAAGAGGAGGG + Intronic
1186206505 X:7206009-7206031 TAGGGGGTGCAGTGGGTGGATGG - Intergenic
1186239965 X:7555307-7555329 GAAGGGAGGAAGGAGGAGGAAGG + Intergenic
1186293224 X:8121847-8121869 GAGGGGATGGGGGAGGGGGAGGG - Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186479020 X:9881716-9881738 TCGGGGAGGCAGAGGGAGGAAGG - Intronic
1186538462 X:10374082-10374104 TAGGGGATGCATGGGTATGAGGG - Intergenic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1187429025 X:19204496-19204518 TAGTGTTTGCAGGAGGACGAAGG + Intergenic
1187504186 X:19865418-19865440 TAGAGGGTGGAGGTGGAGGAGGG + Intronic
1188146674 X:26622263-26622285 TAAGGGAAGGAGGAAGAGGAGGG + Intergenic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189087142 X:38037299-38037321 TAAGGGAGGCAGGAGAAGGCAGG - Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189471477 X:41317827-41317849 TTAGGGATGGGGGAGGAGGAGGG - Intergenic
1190122285 X:47672172-47672194 AAGGGGAAGCATGAGTAGGAAGG - Intergenic
1190223313 X:48527232-48527254 GAGGGGATGCTGGCGGAGAAAGG - Exonic
1190274891 X:48893304-48893326 TATGGGATGGATGAGCAGGAAGG - Intergenic
1190762445 X:53447854-53447876 AAGGGAATGCAGGAGGAAGAGGG - Intergenic
1190795523 X:53737642-53737664 GAGAGGATGCAGGAGGCAGATGG - Intergenic
1191694349 X:63974158-63974180 TGGGGGTTGCAGAATGAGGATGG + Intergenic
1191779554 X:64850712-64850734 AAGGTCATGGAGGAGGAGGAGGG - Intergenic
1192639059 X:72846070-72846092 TGGGAGATGGAGGAGGAAGAGGG + Intronic
1192642653 X:72874738-72874760 TGGGAGATGGAGGAGGAAGAGGG - Intronic
1194033422 X:88842850-88842872 TAGAGGTTGCAGAAGGATGAAGG + Intergenic
1194145648 X:90258690-90258712 TTGGAGATTCAGGAGGGGGAAGG + Intergenic
1194329805 X:92567832-92567854 TGGGGCCTGCTGGAGGAGGAGGG + Intronic
1194806304 X:98332443-98332465 TAGGGGGCAGAGGAGGAGGAGGG + Intergenic
1195059870 X:101183825-101183847 TAGGGGCTGCAGAAGGATGAAGG + Intergenic
1195350157 X:103987935-103987957 CAGCGGATGCAGGAGGAAAAAGG - Intergenic
1195351762 X:104003155-104003177 CAGCGGATGCAGGAGGAAAAAGG + Intergenic
1195629010 X:107034235-107034257 TGGGGGTTGCGGGAGAAGGAAGG + Intergenic
1195696221 X:107669589-107669611 AGGGGGATGGGGGAGGAGGAAGG - Intergenic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1196663549 X:118293640-118293662 TAGGGGTTGCAGAAGGATGGAGG + Intergenic
1197641955 X:128976872-128976894 TACGGGGAGCAGGAGGAGGCAGG - Intergenic
1197710776 X:129665697-129665719 TAGGGGTAGCAGGAGGAACAAGG + Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1197783244 X:130177090-130177112 GATGGGGTGCTGGAGGAGGATGG - Intronic
1198344542 X:135746803-135746825 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1198463591 X:136885163-136885185 TAGAAGATCCATGAGGAGGAGGG - Intergenic
1198804567 X:140481208-140481230 TAGGGGATGCAGGCTGAGGAGGG - Intergenic
1199073904 X:143509246-143509268 GAAGGAATGCAGGTGGAGGAAGG + Intronic
1199215422 X:145255565-145255587 GAAGGAATGCAGGTGGAGGAAGG - Intronic
1199541511 X:148963009-148963031 TTGGGGATGTTGCAGGAGGAAGG + Intronic
1199757044 X:150874472-150874494 GAGGGGCTGCAGGAGTAAGAGGG + Intronic
1200002335 X:153068512-153068534 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1200005389 X:153081498-153081520 TAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1200337944 X:155369833-155369855 GAGGAGAAGCAGGAGAAGGAGGG + Intergenic
1200348526 X:155471393-155471415 GAGGAGAAGCAGGAGAAGGAGGG - Intergenic
1200638507 Y:5687014-5687036 TGGGGCCTGCTGGAGGAGGAGGG + Intronic
1201279285 Y:12327179-12327201 TAGCGGTTTCAGGAGGATGAAGG - Intergenic
1201486138 Y:14496469-14496491 AAGAGGAGGCAGGATGAGGAAGG - Intergenic
1201701512 Y:16887443-16887465 AAGGGGGTGCAAGAGGAGAAAGG - Intergenic