ID: 1049555811

View in Genome Browser
Species Human (GRCh38)
Location 8:143281444-143281466
Sequence CCTGCGAAGCCCTCTCCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049555811_1049555816 4 Left 1049555811 8:143281444-143281466 CCCTAAGGAGAGGGCTTCGCAGG No data
Right 1049555816 8:143281471-143281493 TGGTCCCTGACCTGGCCCCGAGG No data
1049555811_1049555819 8 Left 1049555811 8:143281444-143281466 CCCTAAGGAGAGGGCTTCGCAGG No data
Right 1049555819 8:143281475-143281497 CCCTGACCTGGCCCCGAGGGTGG No data
1049555811_1049555821 9 Left 1049555811 8:143281444-143281466 CCCTAAGGAGAGGGCTTCGCAGG No data
Right 1049555821 8:143281476-143281498 CCTGACCTGGCCCCGAGGGTGGG No data
1049555811_1049555815 -4 Left 1049555811 8:143281444-143281466 CCCTAAGGAGAGGGCTTCGCAGG No data
Right 1049555815 8:143281463-143281485 CAGGTCTCTGGTCCCTGACCTGG No data
1049555811_1049555817 5 Left 1049555811 8:143281444-143281466 CCCTAAGGAGAGGGCTTCGCAGG No data
Right 1049555817 8:143281472-143281494 GGTCCCTGACCTGGCCCCGAGGG No data
1049555811_1049555822 10 Left 1049555811 8:143281444-143281466 CCCTAAGGAGAGGGCTTCGCAGG No data
Right 1049555822 8:143281477-143281499 CTGACCTGGCCCCGAGGGTGGGG No data
1049555811_1049555828 29 Left 1049555811 8:143281444-143281466 CCCTAAGGAGAGGGCTTCGCAGG No data
Right 1049555828 8:143281496-143281518 GGGGACAGATCCCCGAGGCGAGG No data
1049555811_1049555827 24 Left 1049555811 8:143281444-143281466 CCCTAAGGAGAGGGCTTCGCAGG No data
Right 1049555827 8:143281491-143281513 AGGGTGGGGACAGATCCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049555811 Original CRISPR CCTGCGAAGCCCTCTCCTTA GGG (reversed) Intergenic
No off target data available for this crispr