ID: 1049557605

View in Genome Browser
Species Human (GRCh38)
Location 8:143290979-143291001
Sequence CCCGAGCGTGGGCTTCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049557605_1049557614 2 Left 1049557605 8:143290979-143291001 CCCCAAGGAAGCCCACGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1049557614 8:143291004-143291026 CCGCGTGCTGCCACAGCCCCGGG 0: 1
1: 0
2: 0
3: 29
4: 279
1049557605_1049557620 13 Left 1049557605 8:143290979-143291001 CCCCAAGGAAGCCCACGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1049557620 8:143291015-143291037 CACAGCCCCGGGGGCCTGGAGGG 0: 1
1: 1
2: 5
3: 58
4: 574
1049557605_1049557615 3 Left 1049557605 8:143290979-143291001 CCCCAAGGAAGCCCACGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1049557615 8:143291005-143291027 CGCGTGCTGCCACAGCCCCGGGG 0: 1
1: 0
2: 1
3: 13
4: 124
1049557605_1049557616 4 Left 1049557605 8:143290979-143291001 CCCCAAGGAAGCCCACGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1049557616 8:143291006-143291028 GCGTGCTGCCACAGCCCCGGGGG 0: 1
1: 0
2: 2
3: 17
4: 177
1049557605_1049557625 30 Left 1049557605 8:143290979-143291001 CCCCAAGGAAGCCCACGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1049557625 8:143291032-143291054 GGAGGGTCCCGTGAGCCGAGCGG 0: 1
1: 0
2: 7
3: 170
4: 1358
1049557605_1049557617 9 Left 1049557605 8:143290979-143291001 CCCCAAGGAAGCCCACGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1049557617 8:143291011-143291033 CTGCCACAGCCCCGGGGGCCTGG 0: 1
1: 0
2: 5
3: 55
4: 488
1049557605_1049557612 1 Left 1049557605 8:143290979-143291001 CCCCAAGGAAGCCCACGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1049557612 8:143291003-143291025 CCCGCGTGCTGCCACAGCCCCGG 0: 1
1: 0
2: 0
3: 17
4: 271
1049557605_1049557619 12 Left 1049557605 8:143290979-143291001 CCCCAAGGAAGCCCACGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1049557619 8:143291014-143291036 CCACAGCCCCGGGGGCCTGGAGG 0: 1
1: 1
2: 6
3: 57
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049557605 Original CRISPR CCCGAGCGTGGGCTTCCTTG GGG (reversed) Intronic