ID: 1049557605

View in Genome Browser
Species Human (GRCh38)
Location 8:143290979-143291001
Sequence CCCGAGCGTGGGCTTCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049557605_1049557615 3 Left 1049557605 8:143290979-143291001 CCCCAAGGAAGCCCACGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1049557615 8:143291005-143291027 CGCGTGCTGCCACAGCCCCGGGG 0: 1
1: 0
2: 1
3: 13
4: 124
1049557605_1049557617 9 Left 1049557605 8:143290979-143291001 CCCCAAGGAAGCCCACGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1049557617 8:143291011-143291033 CTGCCACAGCCCCGGGGGCCTGG 0: 1
1: 0
2: 5
3: 55
4: 488
1049557605_1049557625 30 Left 1049557605 8:143290979-143291001 CCCCAAGGAAGCCCACGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1049557625 8:143291032-143291054 GGAGGGTCCCGTGAGCCGAGCGG 0: 1
1: 0
2: 7
3: 170
4: 1358
1049557605_1049557616 4 Left 1049557605 8:143290979-143291001 CCCCAAGGAAGCCCACGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1049557616 8:143291006-143291028 GCGTGCTGCCACAGCCCCGGGGG 0: 1
1: 0
2: 2
3: 17
4: 177
1049557605_1049557612 1 Left 1049557605 8:143290979-143291001 CCCCAAGGAAGCCCACGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1049557612 8:143291003-143291025 CCCGCGTGCTGCCACAGCCCCGG 0: 1
1: 0
2: 0
3: 17
4: 271
1049557605_1049557620 13 Left 1049557605 8:143290979-143291001 CCCCAAGGAAGCCCACGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1049557620 8:143291015-143291037 CACAGCCCCGGGGGCCTGGAGGG 0: 1
1: 1
2: 5
3: 58
4: 574
1049557605_1049557614 2 Left 1049557605 8:143290979-143291001 CCCCAAGGAAGCCCACGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1049557614 8:143291004-143291026 CCGCGTGCTGCCACAGCCCCGGG 0: 1
1: 0
2: 0
3: 29
4: 279
1049557605_1049557619 12 Left 1049557605 8:143290979-143291001 CCCCAAGGAAGCCCACGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1049557619 8:143291014-143291036 CCACAGCCCCGGGGGCCTGGAGG 0: 1
1: 1
2: 6
3: 57
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049557605 Original CRISPR CCCGAGCGTGGGCTTCCTTG GGG (reversed) Intronic
900374672 1:2348022-2348044 CCCCAGCCTGGGCTTCCCCGTGG + Intronic
901238269 1:7679048-7679070 CCCTAGCATGGGCTGCCCTGGGG + Intronic
906068285 1:42998342-42998364 CCCGCGCCTGGCCTTCCATGTGG + Intergenic
906960585 1:50417278-50417300 CCCCAGCTTGGGCACCCTTGCGG - Intergenic
915318986 1:155045815-155045837 CCCAAACATGGGCTTCCTTGAGG - Intronic
920658198 1:207892011-207892033 CCCCATCTTGGGCTTCCTGGAGG - Intronic
922478692 1:225924089-225924111 CATGAGCGTGGGCTTCATCGGGG - Exonic
923212183 1:231813454-231813476 CCAGAGCATGGGGTCCCTTGAGG + Intronic
923630947 1:235649429-235649451 CCCGCGCGCGGGCTTCCCCGGGG + Intronic
1063699001 10:8366368-8366390 GCAGAGGGTGGGATTCCTTGAGG + Intergenic
1064189716 10:13195157-13195179 CCCCAGCTTGGGCGTCATTGTGG - Exonic
1068310568 10:55269223-55269245 GGCGAGAGTGGGCATCCTTGTGG - Intronic
1069553864 10:69383823-69383845 CCCCAGCCTGGGCTTCCAGGAGG - Intronic
1069804137 10:71107307-71107329 CCCAAGCGTTGGCTTCCATGTGG + Intergenic
1070669660 10:78369085-78369107 CCCCAGCGAGGGCTTCCAGGAGG - Intergenic
1076658243 10:132038308-132038330 CCTGTGCGTGGGCTCCCTCGGGG - Intergenic
1077460261 11:2705568-2705590 CCCGAGCTTGGGATGCTTTGTGG - Intronic
1082159927 11:48879997-48880019 CCAGAGCTAGGGCTTCCCTGAGG + Intergenic
1082162846 11:48902270-48902292 CCAGAGCTAGGGCTTCCCTGGGG - Intergenic
1085260983 11:75204570-75204592 CCCGAGTGTGAGCTGTCTTGGGG + Exonic
1088756501 11:112889679-112889701 CCTGAGCCTGGGCTTTCCTGAGG + Intergenic
1092754943 12:11754393-11754415 CAGGAGCGAGGGCCTCCTTGGGG - Intronic
1095672364 12:44876234-44876256 CCCCAGCCCGGGCTTTCTTGGGG - Intronic
1096863048 12:54543646-54543668 CCTGAGAGTGGGTATCCTTGAGG + Exonic
1101071596 12:101081522-101081544 TCCCAGCTTGGGATTCCTTGTGG + Intronic
1112561886 13:100522498-100522520 CTAGAGAGTGGGCTTCCTGGGGG + Intronic
1117072527 14:52069354-52069376 CCCGGGGGTGGGGCTCCTTGGGG - Intergenic
1122892455 14:104739091-104739113 CACGAGAGTGGGCATCCTGGCGG + Intronic
1128751955 15:70156242-70156264 TCCTAACCTGGGCTTCCTTGGGG - Intergenic
1133128722 16:3663339-3663361 CCGCAGCGAGGGCTTCCTTTGGG - Exonic
1134372945 16:13642547-13642569 CCCAAGAGAGGGCTTCCTTAGGG - Intergenic
1135436240 16:22428593-22428615 CCTGAGCCTGGGTTCCCTTGGGG + Intronic
1135734672 16:24921181-24921203 CTTGACCGTGGGCTTCATTGAGG - Intronic
1140584833 16:76277235-76277257 CCCGTTCGTGGGCCTCCTTGGGG - Intergenic
1140910123 16:79443450-79443472 CCCAAGCCTGGGCTTCCTGGGGG + Intergenic
1142045454 16:87922427-87922449 CCTGAGCCTGGGTTCCCTTGGGG + Intronic
1143095741 17:4477393-4477415 CCTGAGCCTGGGCTACCCTGGGG + Intronic
1143158116 17:4851698-4851720 CCCGAGAGTGGACTTTCTTAAGG - Intronic
1143766549 17:9141490-9141512 CCTTAGCGTGGGCGTCCTGGTGG + Intronic
1148197956 17:45728473-45728495 CACTAGCCTGGGCTTTCTTGTGG - Intergenic
1161645531 19:5451212-5451234 CCCAAGCCTGGGGCTCCTTGAGG + Intergenic
1163581867 19:18144160-18144182 CCCTAGACTGGGGTTCCTTGGGG - Intronic
1166968346 19:46544826-46544848 CACGAGCGTGGGCCTCACTGAGG + Intronic
1167612041 19:50512388-50512410 CCCCAGCCTGGGCTTCGATGGGG - Exonic
925304320 2:2837874-2837896 CCTGAGCCTGGGCTTCACTGAGG - Intergenic
925304356 2:2838015-2838037 CCTGAGCCTGGGCTTCACTGAGG - Intergenic
929714914 2:44300287-44300309 CCAGAGCGAGGGATCCCTTGAGG + Intronic
929890831 2:45917747-45917769 CCCGACCGTGAGCTCCCGTGCGG - Intronic
935386227 2:102502548-102502570 CCCAAGCGTGTCCTTCCTTGGGG - Intronic
939570996 2:143839558-143839580 TCTGAGCCTGGGTTTCCTTGAGG - Intergenic
941567566 2:167128000-167128022 ACTGATCGTGGGCTTCCTTCCGG - Intronic
1176046818 20:63097147-63097169 CCTGACCTTGGGCTTCCCTGGGG - Intergenic
1179225065 21:39445775-39445797 CCCGCGCGCGGGTTTCCATGGGG - Intronic
1183870333 22:40736970-40736992 CCCGGGCCTGGGCAGCCTTGGGG + Intergenic
1184412938 22:44336381-44336403 CCCGACAGTGAGCTTCTTTGGGG - Intergenic
1184466685 22:44672671-44672693 CCCAAGCGTGGGCTACCCTCTGG + Intronic
952507641 3:34021946-34021968 GCTGAGTGTGGGCTTCCTTTAGG + Intergenic
953917825 3:46931768-46931790 CCTGGGCGTGGCCTTCCCTGTGG - Intronic
954108317 3:48420806-48420828 CCCAGGCCTGGGCTTCCCTGTGG - Intronic
979674977 4:123399655-123399677 CCAGACCGTGGGCTTGCTTTGGG + Intronic
984918146 4:184741489-184741511 CCCGACCGTGGGCTCCTGTGCGG + Intergenic
1005751269 6:28885210-28885232 CCCACCCGTGGGCTCCCTTGCGG - Intergenic
1006595832 6:35192127-35192149 CCCCAGCCTGGGCTTTCTTTGGG - Intergenic
1013957281 6:115855484-115855506 CCCCACCGTGGGCTTCCGCGTGG + Intergenic
1014712021 6:124817473-124817495 GGCTAGCTTGGGCTTCCTTGTGG + Intronic
1018851449 6:167643493-167643515 CCCTTGCGTGAGTTTCCTTGTGG - Intergenic
1019291047 7:250445-250467 CCTGAGCGTGGGGGTCTTTGAGG + Intronic
1020342784 7:7130897-7130919 CCCCAGCTTGAGATTCCTTGGGG + Intergenic
1034999686 7:155603008-155603030 CACCAGCGTGGGCATCCTGGAGG - Intergenic
1048552097 8:135442913-135442935 CCCACGCGTGGACTTCCTTCAGG - Intergenic
1049319974 8:141991102-141991124 CCCCACCGTGGGCTTCCTGGGGG + Intergenic
1049557605 8:143290979-143291001 CCCGAGCGTGGGCTTCCTTGGGG - Intronic
1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG + Intergenic
1053013186 9:34647003-34647025 CCCGAGCTTGGGCCTGCTGGTGG + Intronic
1055459078 9:76500038-76500060 CCAATGCCTGGGCTTCCTTGGGG + Intronic
1057490364 9:95515915-95515937 CGCGAGCGTGCCCTTCCCTGCGG + Intronic
1061860345 9:133464751-133464773 CCCCAGCGTGGGCTTCCCCTGGG + Intronic
1062022826 9:134327173-134327195 CCCGGGCGTGGGCTGCTTTGGGG - Intronic
1191103972 X:56760861-56760883 CCCAAGGGTGGGATTTCTTGAGG - Intergenic
1191111168 X:56803998-56804020 CCCAAGGGTGGGATTTCTTGAGG - Intergenic
1201439708 Y:13994371-13994393 CCAGGGCGTGGGCTTGTTTGAGG + Intergenic
1201444863 Y:14048337-14048359 CCAGGGCGTGGGCTTGTTTGAGG - Intergenic