ID: 1049563301

View in Genome Browser
Species Human (GRCh38)
Location 8:143324264-143324286
Sequence CTGGGGCAGCAAATCTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 127}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049563287_1049563301 21 Left 1049563287 8:143324220-143324242 CCCAAACCTCGTGCTTCTCCACT 0: 1
1: 0
2: 1
3: 18
4: 165
Right 1049563301 8:143324264-143324286 CTGGGGCAGCAAATCTAGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 127
1049563285_1049563301 23 Left 1049563285 8:143324218-143324240 CCCCCAAACCTCGTGCTTCTCCA 0: 1
1: 1
2: 3
3: 30
4: 190
Right 1049563301 8:143324264-143324286 CTGGGGCAGCAAATCTAGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 127
1049563288_1049563301 20 Left 1049563288 8:143324221-143324243 CCAAACCTCGTGCTTCTCCACTC 0: 1
1: 0
2: 1
3: 13
4: 218
Right 1049563301 8:143324264-143324286 CTGGGGCAGCAAATCTAGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 127
1049563299_1049563301 -10 Left 1049563299 8:143324251-143324273 CCGTGGTCAGGGGCTGGGGCAGC 0: 1
1: 0
2: 4
3: 51
4: 516
Right 1049563301 8:143324264-143324286 CTGGGGCAGCAAATCTAGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 127
1049563292_1049563301 3 Left 1049563292 8:143324238-143324260 CCACTCAGTGGTGCCGTGGTCAG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1049563301 8:143324264-143324286 CTGGGGCAGCAAATCTAGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 127
1049563283_1049563301 27 Left 1049563283 8:143324214-143324236 CCCTCCCCCAAACCTCGTGCTTC 0: 1
1: 0
2: 2
3: 26
4: 301
Right 1049563301 8:143324264-143324286 CTGGGGCAGCAAATCTAGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 127
1049563289_1049563301 15 Left 1049563289 8:143324226-143324248 CCTCGTGCTTCTCCACTCAGTGG 0: 1
1: 0
2: 2
3: 11
4: 140
Right 1049563301 8:143324264-143324286 CTGGGGCAGCAAATCTAGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 127
1049563286_1049563301 22 Left 1049563286 8:143324219-143324241 CCCCAAACCTCGTGCTTCTCCAC 0: 1
1: 0
2: 1
3: 13
4: 177
Right 1049563301 8:143324264-143324286 CTGGGGCAGCAAATCTAGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 127
1049563284_1049563301 26 Left 1049563284 8:143324215-143324237 CCTCCCCCAAACCTCGTGCTTCT 0: 1
1: 0
2: 0
3: 17
4: 299
Right 1049563301 8:143324264-143324286 CTGGGGCAGCAAATCTAGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049563301 Original CRISPR CTGGGGCAGCAAATCTAGCT GGG Intronic
900369251 1:2324092-2324114 CTGCGGCAGCACACCTAGGTAGG - Exonic
901020123 1:6251125-6251147 CTGGGGCAGCCAAGCCAGATAGG + Intronic
901210270 1:7520595-7520617 CTGGGGCAGCCACCCTAGCAAGG - Intronic
901730235 1:11273626-11273648 CTGGGGGAGCCTATCTTGCTCGG - Exonic
901828948 1:11880481-11880503 CTGGGGCAGTAAAGATGGCTGGG - Intergenic
903603338 1:24557579-24557601 ATGGGGCAGGAACTCTAGGTAGG + Intronic
903853678 1:26322909-26322931 CTGGGCTAGCAAGGCTAGCTGGG - Intronic
906015605 1:42576228-42576250 CTGGGGCATCATCTCTAGCCTGG - Intronic
909196424 1:72631638-72631660 CTGGGGAAACAAACCTGGCTGGG + Intergenic
909914690 1:81302672-81302694 CGGGTGCAGCAAATCAAGGTGGG - Intergenic
914922885 1:151859513-151859535 CTGGGGCAGCAGATCTAGACAGG - Intergenic
919253213 1:195086040-195086062 TGGAGGCAGTAAATCTAGCTGGG + Intergenic
919704441 1:200663111-200663133 CTGGGGCAGCAGTACCAGCTGGG - Intronic
920946097 1:210529840-210529862 GTGGGCCAGCAAATCAGGCTGGG - Intronic
921784749 1:219216783-219216805 CTGGGGAGGGAGATCTAGCTGGG - Intergenic
1068874543 10:61982300-61982322 CTGGTCCAACAATTCTAGCTCGG - Intronic
1069841142 10:71340125-71340147 CTGGGGCAGAGAAACTTGCTTGG + Intronic
1069987241 10:72292779-72292801 CTGGGGCACCAATTCTAGGAGGG - Intergenic
1071164688 10:82791744-82791766 CTGAGGCAGCAAAGCAAGTTGGG - Intronic
1071236617 10:83657277-83657299 CTGGGTCTGCAAAGCCAGCTTGG + Intergenic
1071266660 10:83970752-83970774 GTGGGCCATCACATCTAGCTAGG - Intergenic
1073631779 10:105156669-105156691 CTGGGGCAGATGATCCAGCTTGG - Intronic
1075643483 10:124082210-124082232 CTGGGGCAGCAGATTAAGGTGGG - Intronic
1076880938 10:133238903-133238925 GTGGGGCAGGATAGCTAGCTGGG - Intronic
1078535568 11:12170738-12170760 CTGGGGCACCAAACCCAGATTGG - Intronic
1079629764 11:22659626-22659648 ATGGGGCAGCTCATCTGGCTTGG + Intronic
1080706610 11:34701379-34701401 CTGGGTCAGCAGACATAGCTGGG - Intergenic
1081856940 11:46309950-46309972 CAGGGGCAGCTAATGGAGCTGGG + Intronic
1082786540 11:57320389-57320411 CTGGGGCTGCACATCGAGCTGGG + Exonic
1090352948 11:126119185-126119207 ATCGGGCAGCAAATCTAGGAAGG + Intergenic
1095989321 12:48023516-48023538 GTGGGGCTGAAGATCTAGCTGGG - Intronic
1099424034 12:82501021-82501043 CTGGGGCAGAAAATCCAGGAAGG + Intergenic
1099566548 12:84255469-84255491 CTGGGGAAGCCAATTTAACTAGG - Intergenic
1099680828 12:85825647-85825669 CTGGGGCAGCCAAATTATCTAGG - Intronic
1101505681 12:105344219-105344241 CTGGGCCAACAAATGCAGCTAGG - Intronic
1102015928 12:109647980-109648002 CTGGGGAACCAATTCTAACTGGG - Intergenic
1104672512 12:130690308-130690330 TTGGGGCAGGGAATCTTGCTGGG + Intronic
1114533285 14:23408445-23408467 CTGGGGCAGCAGACCTTTCTTGG - Intergenic
1116620804 14:47200917-47200939 GTGGGGCAGCAAGCCTCGCTCGG + Intronic
1120305560 14:82765465-82765487 CTGGTACAGCAAATCAGGCTAGG + Intergenic
1120611454 14:86646499-86646521 CTAGGCCAGCAAGTCTTGCTTGG - Intergenic
1121243964 14:92449591-92449613 CTGGGGCAGCAGAGCCAGCCTGG + Intronic
1129056552 15:72824415-72824437 CTGGAGCAGCAAGTCTGTCTGGG + Intergenic
1129373695 15:75114238-75114260 CTGGGGCTCCGAATCCAGCTAGG + Intronic
1133308451 16:4826816-4826838 CTGGGGCAGCACAGCTGTCTTGG + Intronic
1134803631 16:17107181-17107203 ATGGGGCAACACATCTGGCTAGG + Exonic
1136267924 16:29131838-29131860 CTGGGGCAGGGAGTCCAGCTTGG - Intergenic
1138947340 16:61867556-61867578 GTGGGGCTGCAAATCTAGAAGGG + Intronic
1140238110 16:73176927-73176949 CTGATGCTGCAAATCTAGGTGGG - Intergenic
1140294006 16:73690251-73690273 CTGAGTCTGCAAATCTAGTTTGG - Intergenic
1141908262 16:87041671-87041693 CTGGGGCAGCCAGGCTTGCTGGG + Intergenic
1142071231 16:88092176-88092198 CTGGGGCAGGGAGTCCAGCTTGG - Intronic
1145062881 17:19743675-19743697 CTGGGGCCGCAAACCTACCTGGG - Intronic
1151716650 17:75834583-75834605 CTGGGGCTGGGAGTCTAGCTGGG - Intronic
1152930329 17:83106028-83106050 CTGGGGCAGCAGCTCTGACTGGG - Intergenic
1156828457 18:41462310-41462332 CTGGGGTATGAAATCTAGTTAGG + Intergenic
1157781944 18:50447264-50447286 CTGGCACAGCAAATTTAGGTTGG - Intergenic
1161041087 19:2111126-2111148 CTTGGGCAGCACCTCTGGCTTGG - Intronic
1161167463 19:2796126-2796148 CTGGAGCGGCTAATCAAGCTGGG + Exonic
1162789633 19:13056129-13056151 CTGCGGCAGCAAAGTTGGCTGGG - Intronic
1166031824 19:40136993-40137015 CTGAAGCAGCAAATCCTGCTTGG - Intergenic
1168256043 19:55165930-55165952 CAGAAGCAGCACATCTAGCTCGG + Exonic
925510287 2:4617961-4617983 CTGGGCCAGCGGATCCAGCTTGG - Intergenic
928948328 2:36791960-36791982 CTGGGGCATGAAATGCAGCTGGG + Intronic
934090966 2:88550061-88550083 CTGGGGCAGGGAATCTGGCTCGG - Intergenic
935634920 2:105242859-105242881 CTGGGGCAGCAACTCTATGCAGG - Exonic
940436065 2:153656789-153656811 CCGGGGCATCAAATCTGGTTTGG + Intergenic
941407404 2:165107933-165107955 CTTGGGTACCAAATCCAGCTTGG + Intronic
945331066 2:208539958-208539980 ACAGGGCAGCAAATCTTGCTGGG - Intronic
948755054 2:240154814-240154836 CTGGGGCATCACATCCAGCGGGG - Intergenic
1169490777 20:6069763-6069785 GTGGGTCAGCTGATCTAGCTCGG + Intergenic
1169794920 20:9451613-9451635 CTGGGGCAGTAGATCAAGCATGG + Intronic
1169892777 20:10471713-10471735 ATGGGTCAGAAAATCCAGCTGGG + Intronic
1172611793 20:36257929-36257951 CTGAAGCAGCAAATCCAGATGGG + Intronic
1173803541 20:45910016-45910038 CTGTGGCTGGAAATCGAGCTCGG + Exonic
1174215644 20:48914191-48914213 CTGGGGAAGGAACTCTGGCTAGG - Intergenic
1175700833 20:61135951-61135973 CTGGGGCAGCTCCTCTTGCTTGG - Intergenic
1177015513 21:15782272-15782294 CTGGGCCAGCTATTCAAGCTGGG - Intronic
1177115128 21:17075848-17075870 TTGAGTCAGCAAATCTATCTAGG + Intergenic
1180192571 21:46173104-46173126 CTGTGGGAGCAAATCAAGCCTGG - Intronic
1180975107 22:19843950-19843972 CTGAGGCAGTGAATCTTGCTGGG - Intronic
1181657497 22:24315674-24315696 CTGGGGCAGCTAATCCAGAGAGG - Intronic
1182815392 22:33157888-33157910 CTGGGTCTACAAATCTAGGTTGG - Intergenic
1183828242 22:40404959-40404981 CCGGGACATCAAATCCAGCTGGG - Intronic
950796920 3:15517592-15517614 GAGGGTCAGCTAATCTAGCTTGG - Intronic
951892128 3:27577207-27577229 GTGGAGCAGGAAATCTATCTGGG - Intergenic
962629874 3:137264932-137264954 ATGGGCCAGCAACTGTAGCTGGG - Intergenic
965010220 3:163078146-163078168 CTGGTGCAGCAAATATAGGAAGG - Intergenic
968524830 4:1050977-1050999 CTGGGGCAACAAACCCAGCCGGG + Intergenic
969355350 4:6621786-6621808 CTGGGGCTGGAACTCTCGCTAGG - Exonic
969502137 4:7559587-7559609 CTGGAGCAACAAATGTGGCTGGG + Intronic
969662789 4:8539998-8540020 ATGTGGCAGCAAATCTCACTGGG - Intergenic
974723804 4:65773962-65773984 CTGTGGCAGCAAGTTGAGCTTGG + Intergenic
975235888 4:71996445-71996467 GTGAGGCAGCAAACCTGGCTGGG + Intergenic
977307549 4:95343119-95343141 CTCTGGCAGCAAAACTAGCCAGG - Intronic
981613103 4:146617772-146617794 CTGGGCCAGCAGGTCTATCTGGG + Intergenic
984125127 4:175799140-175799162 CTGGGGCAGGAAAACAAGATTGG - Intronic
984843082 4:184086438-184086460 CTGGGGCTGCAGATCTACTTTGG + Intergenic
986803453 5:11285146-11285168 CTGGGGCAGCAGATATAACCTGG - Intronic
986984006 5:13479908-13479930 CTGTGGCAACATATGTAGCTAGG - Intergenic
987224126 5:15821972-15821994 CTGAGGCAGCAAACAGAGCTTGG - Intronic
988448874 5:31319569-31319591 CTGGGGAAGAAAATTTAGGTTGG - Intronic
993307218 5:86288324-86288346 CTGAAGAAGAAAATCTAGCTTGG - Intergenic
996302400 5:122004099-122004121 CTGGTGTAGCAAGTGTAGCTGGG + Intronic
998807927 5:145936996-145937018 CTGGGGCAGCATATACAGGTAGG - Intronic
1000641561 5:163709164-163709186 TTGGGGCCGCAACTATAGCTTGG + Intergenic
1000648176 5:163783476-163783498 CTGGAGCTGAAAATCCAGCTAGG + Intergenic
1001522608 5:172405447-172405469 GTGGGGCAGCAAATCTGACTAGG - Intronic
1012505691 6:99943892-99943914 CTGTGTCAGTAAATCTTGCTGGG - Intronic
1013419031 6:109949530-109949552 CTGGGGCAGGAGCTCTAGCCAGG - Intergenic
1015762812 6:136683365-136683387 CTGGTGCAGCTAATCTGGGTTGG + Intronic
1018278684 6:162161118-162161140 CTGGATGAGAAAATCTAGCTAGG + Intronic
1019490680 7:1311816-1311838 CTGGGGCAGCAGCCGTAGCTGGG + Intergenic
1022638834 7:32162339-32162361 CTGGTGCATCACTTCTAGCTTGG - Intronic
1028280833 7:88925955-88925977 TTGGGGAAGAAAATCTAGCCAGG + Intronic
1031711655 7:125054389-125054411 CAGTGGCAGCAAATGTAGCCAGG - Intergenic
1032353915 7:131191513-131191535 ATGAGGCAGCTATTCTAGCTAGG - Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1045388826 8:101694973-101694995 CTGTGGGAGCAAAGCAAGCTGGG - Intronic
1045707661 8:104945000-104945022 CAGGGGAAGCAAATTTAGCCAGG - Intronic
1048504744 8:135010908-135010930 CTGGGGCATCAAAGTTATCTTGG + Intergenic
1049563301 8:143324264-143324286 CTGGGGCAGCAAATCTAGCTGGG + Intronic
1055632665 9:78239257-78239279 CAACGGCAGCAAAACTAGCTAGG - Intronic
1057431872 9:95002375-95002397 TTGGGGCATAAAATCCAGCTGGG + Intronic
1058225253 9:102353103-102353125 CTGGGGCAGAAAATTTACTTTGG + Intergenic
1060527844 9:124330558-124330580 CTGGGAGAGCAAGTCTAGTTGGG + Intronic
1062058506 9:134481961-134481983 GTGTGGCAGCAAATCCAGCCAGG + Intergenic
1187675075 X:21708212-21708234 CTGGGGCAGAAACTCTGGTTTGG + Intronic
1192318270 X:70068036-70068058 CTGGGGAAGGAAGCCTAGCTGGG + Intergenic
1194316040 X:92379168-92379190 CTGGGGCAGCAGTCCCAGCTGGG - Intronic
1197138667 X:123092173-123092195 CTGGGGCAGCACCTTCAGCTGGG - Intergenic
1199395262 X:147330124-147330146 CTGATTCAGTAAATCTAGCTTGG + Intergenic
1200624086 Y:5490742-5490764 CTGGGGCAGCAGTCCCAGCTGGG - Intronic