ID: 1049565322

View in Genome Browser
Species Human (GRCh38)
Location 8:143335039-143335061
Sequence CAGGGAAACCAGGGGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 601}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049565322_1049565336 12 Left 1049565322 8:143335039-143335061 CCGGCCTCCCCCTGGTTTCCCTG 0: 1
1: 0
2: 3
3: 59
4: 601
Right 1049565336 8:143335074-143335096 AGCGCCCCTTCACGCTGGGCGGG 0: 1
1: 0
2: 1
3: 6
4: 147
1049565322_1049565335 11 Left 1049565322 8:143335039-143335061 CCGGCCTCCCCCTGGTTTCCCTG 0: 1
1: 0
2: 3
3: 59
4: 601
Right 1049565335 8:143335073-143335095 CAGCGCCCCTTCACGCTGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 87
1049565322_1049565337 13 Left 1049565322 8:143335039-143335061 CCGGCCTCCCCCTGGTTTCCCTG 0: 1
1: 0
2: 3
3: 59
4: 601
Right 1049565337 8:143335075-143335097 GCGCCCCTTCACGCTGGGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 114
1049565322_1049565332 7 Left 1049565322 8:143335039-143335061 CCGGCCTCCCCCTGGTTTCCCTG 0: 1
1: 0
2: 3
3: 59
4: 601
Right 1049565332 8:143335069-143335091 GGTCCAGCGCCCCTTCACGCTGG 0: 1
1: 0
2: 0
3: 5
4: 58
1049565322_1049565333 8 Left 1049565322 8:143335039-143335061 CCGGCCTCCCCCTGGTTTCCCTG 0: 1
1: 0
2: 3
3: 59
4: 601
Right 1049565333 8:143335070-143335092 GTCCAGCGCCCCTTCACGCTGGG 0: 1
1: 0
2: 2
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049565322 Original CRISPR CAGGGAAACCAGGGGGAGGC CGG (reversed) Intronic
900565418 1:3329572-3329594 CAGGAAAACCAGGCAGAGGAAGG + Intronic
900831616 1:4969671-4969693 CAGGGAGGTCATGGGGAGGCTGG + Intergenic
901956974 1:12793412-12793434 CAGTGATCCCAGAGGGAGGCAGG - Exonic
901964979 1:12859194-12859216 CAGCGATACCAGAGGGAGGCAGG - Exonic
901972299 1:12917877-12917899 CAGGGACCCTAGAGGGAGGCGGG - Exonic
901980370 1:13029548-13029570 CAGTGATCCCAGAGGGAGGCAGG - Intronic
901989066 1:13097765-13097787 CAGCGATCCCAGAGGGAGGCGGG + Intergenic
901992747 1:13129002-13129024 CAGCGATCCCAGAGGGAGGCGGG - Intergenic
902001717 1:13199383-13199405 CAGTGATCCCAGAGGGAGGCAGG + Intergenic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902012880 1:13283885-13283907 CAGGGACCCTAGAGGGAGGCGGG + Exonic
902020945 1:13345108-13345130 CAGTGATCCCAGAGGGAGGCAGG + Exonic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902043971 1:13512101-13512123 CAGGGTCACAAGTGGGAGGCTGG + Intronic
902350445 1:15849602-15849624 CTGAGAAACCAGGCGGGGGCGGG + Intronic
902571328 1:17348810-17348832 CTGGGAAAGCAGGGAGAGGGAGG - Intronic
902575096 1:17372618-17372640 CTGTGAAACCATGGGGACGCTGG + Intronic
902603580 1:17556198-17556220 CTGGGAGCACAGGGGGAGGCTGG + Intronic
902816516 1:18919413-18919435 CAGGGGAGCCCGGGGGAGGGCGG + Intronic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
902928783 1:19715920-19715942 CAGGGACTCCAGGGAGGGGCAGG - Intronic
903135867 1:21308831-21308853 AAGGGAAACCCTGGGCAGGCAGG - Intronic
904329576 1:29749507-29749529 CAGAGAAAGCAGGGTGAGGGAGG + Intergenic
904375618 1:30080476-30080498 CAGGGGAACCAGGTGCCGGCTGG + Intergenic
904521520 1:31099732-31099754 CAAGGAAAGCAGGGGAAGGGAGG - Intergenic
904603511 1:31686260-31686282 CAGGGTAACTTCGGGGAGGCAGG - Exonic
904705843 1:32390109-32390131 AAGGGCAACCAGGGAGAGCCTGG + Intronic
904747681 1:32720954-32720976 CACGGAAACCAGTGAGAGGGAGG + Intergenic
904828250 1:33289457-33289479 CTGGGAGTCAAGGGGGAGGCCGG + Intronic
905120664 1:35679428-35679450 CAGAGAAGCCAGGAGGAGGGAGG - Intergenic
905237369 1:36559369-36559391 CAGGTAAACCAAGTGGAGGTCGG - Intergenic
905410668 1:37765815-37765837 CTGGGAAACCATGTGGACGCTGG + Intergenic
905835816 1:41119841-41119863 GAGGGAAAAAAGGAGGAGGCAGG - Intronic
906058654 1:42934533-42934555 CAGGAAAGGCAGGGGGATGCTGG + Intronic
906078620 1:43069298-43069320 CTGGGAGGCCAGGGTGAGGCTGG - Intergenic
906091732 1:43185344-43185366 CAGAGAAATCAGGGTAAGGCGGG + Exonic
906146540 1:43563964-43563986 CAGGGAAACCCGAGGAAGGAGGG + Intronic
906291039 1:44619318-44619340 CAAAGAAGCCAGAGGGAGGCTGG + Intronic
906509146 1:46401039-46401061 GAGGGAAACCAGGGGAGGGGAGG + Intronic
907206187 1:52773931-52773953 CAGAGAAACCAGGCCGAGGGTGG - Intronic
907342666 1:53747991-53748013 CAGGGAGACCAATGGGAAGCTGG - Intergenic
907719735 1:56960596-56960618 TAGGGAAACAAGGAAGAGGCTGG + Intronic
908167606 1:61473888-61473910 GAGGGGAACCAGAGGGAGCCAGG - Intergenic
909151130 1:72006754-72006776 CAGGAAAAACTGGGGGGGGCGGG + Intronic
909975747 1:82044296-82044318 CAGTGAATCCAGGGTGAGTCAGG - Intergenic
910881907 1:91929437-91929459 CAGGGAAAACAGGGCAGGGCTGG + Intergenic
912452053 1:109773284-109773306 CTGGGAGACCATGGGGAGGACGG + Intronic
912903248 1:113675420-113675442 CAGGGAAGCCAAGGGGAGAAAGG + Intronic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
914376590 1:147078278-147078300 CTGGGTAACCAGGAGCAGGCAGG - Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
914514568 1:148362882-148362904 GAGGGAAAAGAGGGAGAGGCAGG - Intergenic
914787409 1:150847133-150847155 CAGAAAAAGAAGGGGGAGGCTGG + Intronic
915267118 1:154726847-154726869 CAGGGGAGCCCGGGGGAGGGTGG + Intronic
915279178 1:154810603-154810625 TAGGGAAACCAGGAGAAGGAAGG + Intronic
915341598 1:155179535-155179557 AAGGGAAAGCAGCGGGAGCCGGG - Intronic
915741766 1:158124206-158124228 CAGGGAAACAATGGGGAGTCAGG - Intergenic
915952489 1:160198759-160198781 GAGGGAAGGCAGGGGGAGGTGGG + Intronic
916101862 1:161399764-161399786 TACGGAAACCAGGCGGTGGCAGG + Intergenic
916724075 1:167507329-167507351 CAGGGAAAACATGGAGAGCCAGG + Intronic
919611417 1:199749690-199749712 CAGGGACACCAAGGGTGGGCTGG + Intergenic
919870884 1:201820334-201820356 GAGGGAGATCTGGGGGAGGCAGG + Exonic
920082850 1:203388714-203388736 CATGGATACCAGGTGGAGGGGGG - Intergenic
920097755 1:203497678-203497700 CAGGGAAACCGCGGGCAAGCAGG - Intronic
920184424 1:204151534-204151556 CAGGGCTGCCAGGGGGATGCGGG - Intronic
922338668 1:224638229-224638251 CTGCGCACCCAGGGGGAGGCCGG + Intronic
922560439 1:226565473-226565495 TAGGAAAACCAGGTGGAGGTGGG - Intronic
922562915 1:226582080-226582102 CAGGGCTTCCAGGAGGAGGCTGG - Intronic
922619397 1:226980851-226980873 CTGAGAAACCAGGGTGGGGCGGG - Intronic
1063389756 10:5641578-5641600 CAGGGAACCCAGGGAGAGCTGGG + Intronic
1063881679 10:10538254-10538276 CTGGCAGACCAGAGGGAGGCAGG - Intergenic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1065695242 10:28373673-28373695 TAGGGGACCCAGGGAGAGGCAGG - Intergenic
1065695250 10:28373692-28373714 CAGGGGACCCAGGGAGAGGTAGG - Intergenic
1065933272 10:30497971-30497993 CAGGGAAAGCAAGGGAAGGCAGG - Intergenic
1066239861 10:33523152-33523174 CAGGGAAAAAAGTGGGAAGCTGG + Intergenic
1067440431 10:46306314-46306336 CAAGGAAAGCAGGTGGGGGCAGG - Intronic
1068881231 10:62051161-62051183 CACGGCAACCAGGGGAAGGGAGG - Intronic
1069567817 10:69475118-69475140 AAAGAAAACCAGGGGGAGGAGGG + Intronic
1070577999 10:77694415-77694437 CAGCAAAACCAGGGAGAGGTAGG - Intergenic
1070807208 10:79277631-79277653 CAGAGAAACCAGGGGCTGACAGG + Intronic
1070828306 10:79403855-79403877 CAGGAAAACCCTGGGGAGGGGGG + Intronic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072743084 10:97922085-97922107 ATGGGAAACCGGGAGGAGGCTGG + Intronic
1072800344 10:98388444-98388466 CATGGCAGCCAGGGGGAGCCAGG + Exonic
1072929868 10:99652741-99652763 CAGAGAGACCAGGGTGAGGTAGG - Intergenic
1074504807 10:114060149-114060171 CAGGGAAACCCCAGGTAGGCTGG + Intergenic
1075210365 10:120485831-120485853 CAGGGCAGCCAGGGTGGGGCAGG - Intronic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1076659077 10:132043490-132043512 CAGAGAATCCAGGGGGAAACGGG + Intergenic
1076891086 10:133283748-133283770 CAGGGAATGCAGGGAGACGCAGG - Intronic
1077068710 11:657268-657290 CAGGGAATGCAAGAGGAGGCTGG + Intronic
1077237712 11:1489880-1489902 CTGGGAATGCAGGGGGAGCCTGG - Intronic
1077263164 11:1634052-1634074 CCAGGGCACCAGGGGGAGGCTGG + Intergenic
1077498865 11:2899930-2899952 CAGGGAACCCAGGAGGCGTCTGG + Intronic
1077953811 11:6991356-6991378 TAGGGAAACCAGAGGCAGGGAGG - Intergenic
1078062884 11:8059862-8059884 CAAGGAGACCAGAAGGAGGCTGG + Intronic
1078328371 11:10398525-10398547 CAGGGAAATCAGGGGAAGGATGG + Intronic
1078386167 11:10894855-10894877 TAGTGAGACCAGTGGGAGGCTGG - Intergenic
1078511245 11:11985836-11985858 CAGCAAAACCATGGGGATGCGGG + Intronic
1078672634 11:13378367-13378389 CAGGGATTCCAGGGGGAACCCGG + Exonic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079351325 11:19694425-19694447 CAGGGAAGCCAGGGGAGGGGAGG + Intronic
1080791435 11:35525637-35525659 CAGGGAGGCCGGGGGCAGGCGGG + Intronic
1082160320 11:48882676-48882698 CAGAGAGACCAGGGGGAGTCTGG - Intergenic
1082162046 11:48897730-48897752 CAGAGAGACCAGGGGGAGTCTGG + Intergenic
1082167629 11:48966175-48966197 CAGAGAGACCAGGGAGAGTCTGG + Intergenic
1082239380 11:49855031-49855053 CAGAGAGACCAGGGAGAGTCTGG - Intergenic
1082242767 11:49889321-49889343 CAGAGAGACCAGGGAGAGTCTGG + Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082657260 11:55870130-55870152 CAGAGAGACCAGGGAGAGTCTGG + Intergenic
1082790390 11:57342862-57342884 CAGGGAGCCAAGGAGGAGGCTGG - Intronic
1083234770 11:61344321-61344343 CAGGGAAACAAGTGGAAGGGGGG - Intronic
1083629772 11:64089514-64089536 CATGGATAACAGGAGGAGGCTGG - Intronic
1083742892 11:64720502-64720524 CAGGGAAACCAGGTGTAGGTGGG + Intronic
1083904356 11:65660413-65660435 CAGGGAGCCCACAGGGAGGCTGG - Intronic
1083920070 11:65777830-65777852 CCGGGAGACCAGGTGGGGGCAGG - Exonic
1084201006 11:67558328-67558350 CAGAGAGAGCAGGGGGAGCCTGG - Intergenic
1084296559 11:68216120-68216142 CAGGGAAGCCAGGGCTAGGCTGG + Intergenic
1084533911 11:69745784-69745806 CAGGGAAGCCAGGGCCAGGAAGG + Intergenic
1084662523 11:70554551-70554573 CAGAGGAACCTGGGGGAGGGGGG - Intronic
1085510104 11:77083884-77083906 GAGGGAAACCAAGGCAAGGCAGG - Intronic
1086380158 11:86244555-86244577 GGGGGAAGCCAGGGGGAAGCAGG + Exonic
1087723559 11:101693935-101693957 CTGGGGAACCAGGGGGAGCCTGG + Intronic
1087963988 11:104389788-104389810 GAGGGAGACAAGGGGGAGGGAGG - Intergenic
1088267480 11:108001584-108001606 CAGGGAACCCAGGGAGAGAATGG - Intergenic
1088550775 11:111010324-111010346 CAGGGCCACGAGAGGGAGGCTGG + Intergenic
1089066251 11:115664270-115664292 CAAGTTAACCAGGGGAAGGCAGG - Intergenic
1089128756 11:116195515-116195537 CCAGGAAACCAGAGGGAGTCAGG + Intergenic
1089185755 11:116613677-116613699 GAGGGAAACCAGGGGGTGCTGGG + Intergenic
1089282635 11:117385134-117385156 AAGGGAAAGCAGGGAGAGACAGG - Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1091302968 11:134519384-134519406 CAGGTTATCCAGGGAGAGGCTGG + Intergenic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1091673217 12:2467579-2467601 CAGAGACAGCAGGGGGTGGCGGG + Intronic
1091803441 12:3339698-3339720 CAGGGAACCCAGGGCAAGGCAGG + Intergenic
1091803462 12:3339782-3339804 CAGAGAACCCAGGGCAAGGCAGG + Intergenic
1091891116 12:4055368-4055390 AAGGGAGAGCAGGGGGAAGCTGG - Intergenic
1093057023 12:14566157-14566179 CAGAGGTACCTGGGGGAGGCTGG - Intronic
1093709884 12:22318549-22318571 CAGGGAAAAGAGGGGGAAGGAGG - Intronic
1094118196 12:26939279-26939301 TAGGGAAACCAGTGGAGGGCGGG - Intronic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1095097113 12:38154757-38154779 CAGGGAAAAAAGCGGAAGGCCGG + Intergenic
1097008130 12:55933347-55933369 CAGGGAAACCAGAGGAGGGAAGG + Intronic
1097493341 12:60297186-60297208 GAGGGCAACCTGGAGGAGGCTGG - Intergenic
1097994490 12:65872698-65872720 CAGGAAAACTAGTAGGAGGCTGG - Intronic
1100995441 12:100295731-100295753 GAGGGAGACCATGGGGAGACGGG + Intronic
1101472744 12:105013740-105013762 CAGGGAAGCCAAGGGAAGCCAGG - Intronic
1102605498 12:114064560-114064582 CTGGTAAACCAGAGGGAGTCAGG - Intergenic
1103318765 12:120077951-120077973 GAGGGAAACCAGAGGGACGCAGG - Intronic
1103484525 12:121273903-121273925 CAGGGAACCTTGGGGGCGGCTGG - Intronic
1104916431 12:132267212-132267234 CAGGGGAACCAGGGCGGGGAAGG + Intronic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1106157032 13:27169026-27169048 CCGGCATACCAGGAGGAGGCAGG + Intronic
1106344427 13:28861851-28861873 CAGGGAAACCAGGCACAGGAGGG - Intronic
1106782572 13:33074375-33074397 CAGGGTCACCTGGGAGAGGCTGG - Intergenic
1107054421 13:36087839-36087861 CTGGGAAACAAGGGGAAGGCAGG + Intronic
1107553380 13:41497061-41497083 CAGTGAAACTAGGTGCAGGCTGG - Intergenic
1107821378 13:44288769-44288791 CAGGGACCCTAGGGGGAAGCCGG - Intergenic
1110343517 13:74419410-74419432 GAGGGAAACCATGGGAAGGAAGG - Intergenic
1110705375 13:78597728-78597750 CAGGAAATCCAGGCGGCGGCGGG - Intergenic
1113384773 13:109838762-109838784 CGTGGAATCCAGGTGGAGGCTGG + Intergenic
1113424707 13:110198494-110198516 CAGGGGAACCAGGAGGACCCGGG + Exonic
1113460403 13:110478519-110478541 CAGGGAAACCTGGGGTAGATGGG + Intronic
1113537860 13:111082377-111082399 CAGGGCAGCCAGGAGGACGCTGG - Intergenic
1113728316 13:112622358-112622380 CAGGGACAGCTAGGGGAGGCAGG - Intergenic
1114349698 14:21836230-21836252 TGGGGAAACCAGGAGCAGGCAGG - Intergenic
1118378520 14:65198495-65198517 CAGGCAAAGGAGGGGGATGCTGG + Intergenic
1118631396 14:67706933-67706955 CAGAGAAATTAGGGGGAGGAAGG + Intronic
1118842513 14:69523910-69523932 CAGAGAAGACAGGGTGAGGCTGG + Intronic
1119021992 14:71124015-71124037 CAGGATCACCAGGAGGAGGCGGG - Intergenic
1119480429 14:74954937-74954959 CAGGGAAGCCACAGGGAGGGAGG - Intronic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1119920613 14:78442592-78442614 AAGGGAAGACAGGGAGAGGCAGG + Intronic
1121406379 14:93721572-93721594 AAGGCAAAGGAGGGGGAGGCAGG + Intronic
1122009688 14:98735858-98735880 CAGAGAAACAACGGGGTGGCAGG + Intergenic
1122125529 14:99576586-99576608 CAGGGATGCTAGGGGCAGGCAGG + Intronic
1122529813 14:102417860-102417882 CAGGGGAGCCGTGGGGAGGCTGG + Intronic
1123112424 14:105879634-105879656 CAGGGTGCCCAGGGGCAGGCAGG - Intergenic
1123160138 14:106270179-106270201 GAGGGAAATAATGGGGAGGCAGG - Intergenic
1123506138 15:20942262-20942284 CGGGGACACCACGGGGAGACAGG + Intergenic
1123563366 15:21515969-21515991 CGGGGACACCACGGGGAGACAGG + Intergenic
1123599617 15:21953252-21953274 CGGGGACACCACGGGGAGACAGG + Intergenic
1123898931 15:24856592-24856614 GAGGGAAGACAGGGGGCGGCTGG - Intronic
1124233726 15:27968781-27968803 CAGGGAAACCACACAGAGGCGGG + Intronic
1124512200 15:30336845-30336867 CAGGGAAAGTAAGAGGAGGCAGG + Intergenic
1124687341 15:31793401-31793423 CAGGGAGACCAGGTTGGGGCAGG - Intronic
1124730714 15:32193906-32193928 CAGGGAAAGTAAGAGGAGGCAGG - Intergenic
1124804439 15:32867336-32867358 CAGGGAGAGCAGGGTGAGGCTGG - Intronic
1124848156 15:33311293-33311315 TAGGGGAACAAGGGAGAGGCAGG - Intronic
1125460215 15:39899227-39899249 CAGGCAAAGCAGGGGGTTGCTGG - Intronic
1126176229 15:45738182-45738204 CAGGGAAAGCAAGGGCTGGCTGG + Intergenic
1126432701 15:48603288-48603310 GGGGGAAGCCAGGAGGAGGCAGG + Intronic
1126737963 15:51751240-51751262 CAGGAAAACCTGGGGCGGGCGGG + Intronic
1126850466 15:52793837-52793859 CCAGGGATCCAGGGGGAGGCTGG + Intergenic
1127265158 15:57355142-57355164 CAGGGAAACCAAGGGGAGCCCGG - Intergenic
1127963560 15:63907757-63907779 TAGGGAAGCAAGGAGGAGGCAGG + Exonic
1128240113 15:66095994-66096016 CAGTGAGAACAGGGGGAGCCCGG - Intronic
1128382644 15:67124807-67124829 CAGGGCAGCCGGGGAGAGGCTGG + Intronic
1129105279 15:73302861-73302883 CAGGCTGACCAGGGGAAGGCAGG - Exonic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1129665657 15:77578142-77578164 CAGGGAAACAAGGGTGAGTTGGG - Intergenic
1129803872 15:78438277-78438299 CGGGGGAAGAAGGGGGAGGCCGG - Exonic
1130064639 15:80593771-80593793 CAGGGCAAGCAGGGCGAGGGTGG - Exonic
1130362013 15:83197940-83197962 CAGGAGAACCTGGGGGCGGCGGG + Intronic
1130995158 15:88899366-88899388 CAGGAAGACCTGGGGGTGGCAGG + Exonic
1132143775 15:99414975-99414997 CAAGGAAACCTGGAGGAGGTGGG - Intergenic
1132240623 15:100254832-100254854 CAGGGCCAGCCGGGGGAGGCGGG + Intronic
1202971722 15_KI270727v1_random:243103-243125 CGGGGACACCACGGGGAGACAGG + Intergenic
1132554908 16:568145-568167 CAGGGAGCCCAGGGGTTGGCGGG - Exonic
1132717844 16:1301063-1301085 CAGGGCCAGCAGGGGGCGGCAGG + Intergenic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1132892793 16:2212547-2212569 GAGGGAATCCAGGGCAAGGCAGG + Exonic
1133037261 16:3040630-3040652 CAGGGAAGGCCCGGGGAGGCTGG + Intergenic
1134215895 16:12316733-12316755 CAGAGAAGCCAGGGGCAGGAAGG - Intronic
1134229489 16:12417833-12417855 CAAGAAAAACAGGGAGAGGCAGG - Intronic
1134449215 16:14353725-14353747 CAGGGGAAGGTGGGGGAGGCAGG + Intergenic
1134614888 16:15643256-15643278 CTGGGAACCCCGGGGGGGGCGGG + Exonic
1135156039 16:20053376-20053398 CAAGGAAACCCTGGGCAGGCAGG - Intronic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1135973874 16:27092797-27092819 CAGGTAACCCAGAGGAAGGCAGG + Intergenic
1136544452 16:30947740-30947762 TAGGGGAACCAGGGGCAAGCTGG + Exonic
1137466426 16:48713971-48713993 CAGAGAAAGAAGGGGGAGGGAGG - Intergenic
1137610963 16:49817235-49817257 AGGGGAGAGCAGGGGGAGGCAGG + Intronic
1137948179 16:52755975-52755997 CAGAGTAACCAGGAGGAGCCAGG + Intergenic
1138488974 16:57365096-57365118 TAGGAAAAAAAGGGGGAGGCTGG - Exonic
1138529729 16:57628483-57628505 GAGGGAGACCAGGAGGGGGCAGG - Intronic
1138627897 16:58266933-58266955 CACAGAGACCAGGGGGAGCCGGG - Intronic
1138633632 16:58319394-58319416 CAGGGAGACCAGTGAGGGGCAGG - Intronic
1140299653 16:73744457-73744479 CAGAAATACCAGGGTGAGGCAGG - Intergenic
1141767759 16:86070101-86070123 CACCGAAGCCAGAGGGAGGCAGG + Intergenic
1141945333 16:87305499-87305521 CAGGGCAGCCTGGGGGCGGCGGG - Intronic
1142175901 16:88645183-88645205 CAGGGAGACGGGGGGGATGCGGG + Intronic
1142294237 16:89209869-89209891 CAGGGAGACCTGGGGGAGACCGG + Intergenic
1142359495 16:89619573-89619595 CAGGGGGACCAGGGGGCTGCAGG - Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142748716 17:1974646-1974668 CAGGGAAGCCAGGTGGAGACGGG + Intronic
1142905787 17:3040958-3040980 CAGGGAAACCAGAGAGAGCCAGG - Intergenic
1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG + Intronic
1143296449 17:5875170-5875192 CAGGGGCACCAGCTGGAGGCAGG + Intronic
1143411292 17:6711025-6711047 GAGGGAATCCAGGTGGAGACAGG + Intronic
1143620102 17:8075780-8075802 CAGGGCACCCTGGGGGAGGTGGG - Intronic
1143629597 17:8130460-8130482 CAGGAAAACCAGGGGGAGTGGGG + Intergenic
1144182297 17:12763485-12763507 CTGGGAAACCATGGAGTGGCTGG + Exonic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1144631864 17:16877693-16877715 CAGGGGGACATGGGGGAGGCAGG - Intergenic
1144763048 17:17718127-17718149 CAGGGGAAGCAGGGGGAGAGGGG - Intronic
1144775665 17:17783398-17783420 CCGGGAAACAAGGCGGGGGCGGG + Intronic
1144807516 17:17977671-17977693 CAGGGCCCCCAGGAGGAGGCCGG + Exonic
1145006653 17:19342379-19342401 CAGGGCAACATGGGCGAGGCTGG + Intronic
1145747758 17:27332793-27332815 CAGGGAAAACTGGGTCAGGCCGG - Intergenic
1145756917 17:27398949-27398971 CAGGGAACCCAGGTTGAGGGTGG - Intergenic
1145985446 17:29042968-29042990 CAGGGATGCAAGGGTGAGGCTGG + Exonic
1146382651 17:32342240-32342262 CGGGGAAACCAGCGGAACGCAGG - Intronic
1146943087 17:36857337-36857359 CAGGGAGACAAGGCGGAGGGAGG - Intergenic
1147418665 17:40311223-40311245 GAGGGAAGCCAGTGGGAGGATGG + Intronic
1147637320 17:41972044-41972066 CAGGGACACATGGGGGAGGTGGG + Intronic
1148322890 17:46768281-46768303 CCGGGAAGCAGGGGGGAGGCTGG - Intronic
1148392073 17:47279937-47279959 CAGGGACAACAGGAGGAGTCTGG + Intronic
1148617709 17:49013514-49013536 CCGGGAAGCCAGGGAGAGGCTGG - Intronic
1148901663 17:50883216-50883238 CAGGGAAACCAGTAGGCGGCTGG - Intergenic
1149297492 17:55273772-55273794 AAGGGAAGCGAGGGGGAGGAGGG - Intronic
1149301167 17:55305594-55305616 CTAGAAAGCCAGGGGGAGGCTGG - Intronic
1149342236 17:55698985-55699007 CAGGGAGGCCAGGGGAAGGGAGG + Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149606262 17:57927212-57927234 AAGGGCATCCAGGGGCAGGCGGG + Intronic
1149629933 17:58114346-58114368 AAGGGAACCCAGGTGGAGCCAGG - Intergenic
1150149633 17:62798625-62798647 CAGGGAATCCATGGGAGGGCAGG + Intronic
1151337294 17:73447489-73447511 CAGGGAAGCTAGGGGACGGCCGG - Intronic
1151471115 17:74318337-74318359 CCGGTACACCAGTGGGAGGCAGG + Intergenic
1152021579 17:77782551-77782573 CAGGGAACCCACTGGCAGGCAGG + Intergenic
1152025226 17:77804670-77804692 CAGGGAAAACTGTGGGAGCCTGG - Intergenic
1152282912 17:79395974-79395996 AACGGAAACCAGTGGCAGGCGGG - Intronic
1152727089 17:81952798-81952820 CAGGGAAAGCCGGGGCAGGAGGG + Exonic
1152737378 17:82004186-82004208 CTGGGAAACCGAGGGGAGGGAGG - Intronic
1152907754 17:82978193-82978215 AAGGGACCCCAGGAGGAGGCAGG - Intronic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1153941892 18:9985852-9985874 CTGGGAGACCTGGGGCAGGCAGG + Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1154355333 18:13620052-13620074 CTGGGAACCGAGGGTGAGGCTGG - Intronic
1155680852 18:28483698-28483720 CAGGGAAAGAAGTGGGAGGCAGG + Intergenic
1156409581 18:36815056-36815078 CAGGTACACCAGATGGAGGCTGG + Intronic
1157403992 18:47408529-47408551 CAGGAAAGCCAGGGTGTGGCTGG + Intergenic
1157600490 18:48890209-48890231 CAGGGCAGAGAGGGGGAGGCCGG - Intergenic
1157682259 18:49616321-49616343 CAGGGGTGCCAAGGGGAGGCTGG - Intergenic
1157698267 18:49742253-49742275 CATGGAATCCAGGTGGATGCAGG - Intergenic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1160136284 18:76274340-76274362 CAGGGCAACCAGGGGGCTGAGGG + Intergenic
1160157185 18:76442762-76442784 CAGGGACACGAGCCGGAGGCGGG - Exonic
1160208435 18:76857038-76857060 CGTGGGAACTAGGGGGAGGCAGG - Intronic
1160219235 18:76960503-76960525 TAGGGAGACCAGAGGGAGCCTGG - Intronic
1160373156 18:78390980-78391002 CGGGGAAAGCACGGTGAGGCCGG - Intergenic
1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG + Intergenic
1160425066 18:78773726-78773748 CAGGGAACCCCTGGGCAGGCAGG + Intergenic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1160814368 19:1028426-1028448 GCGGGAAGCCAGGGGGAAGCTGG - Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1160955300 19:1688542-1688564 CTGGGAGACCAGGTGGAGACGGG + Intergenic
1161172489 19:2819988-2820010 CAGGGACACGCAGGGGAGGCCGG + Exonic
1161176743 19:2847892-2847914 GAGGTAAACCAAGGGGAAGCAGG + Intronic
1161176755 19:2847972-2847994 TAGGTAAACCCTGGGGAGGCAGG - Intronic
1161450883 19:4344598-4344620 CTGGGAAACCACAGGAAGGCCGG - Intronic
1161703120 19:5805449-5805471 CAGGTAAGCAAGGGGCAGGCGGG + Intergenic
1161874293 19:6895628-6895650 CTTGGAATCCAAGGGGAGGCAGG + Intronic
1162463367 19:10826432-10826454 CAGGGAACCCGGGGCCAGGCGGG - Intronic
1162743435 19:12786225-12786247 CAGGGACACGGGAGGGAGGCTGG + Intronic
1162926044 19:13930938-13930960 CAGGGGAACCGGGGGGTGGGTGG - Intergenic
1163737498 19:18990372-18990394 CAGAGGAACCATGGGCAGGCTGG + Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164626731 19:29734269-29734291 CTGGAAACCCAGGGGGTGGCGGG - Intergenic
1164682737 19:30146323-30146345 CAGGGCAGCCAGGGCGGGGCAGG + Intergenic
1164798401 19:31055071-31055093 CAGGGCAAGCAGGGAGAGGGAGG + Intergenic
1164803594 19:31098698-31098720 CATGGGAACCAGGAGGAAGCAGG - Intergenic
1164824259 19:31273038-31273060 CAGGGAAACCAGGGCCATTCTGG + Intergenic
1164924988 19:32123739-32123761 CATGGAAACCCCGGGGAGGGCGG + Intergenic
1165170763 19:33890118-33890140 CAGGGAAGCCATGGGGAGTCCGG + Intergenic
1165308141 19:35014476-35014498 CTGAGAATCCAGGGGCAGGCGGG + Intronic
1165443841 19:35845902-35845924 CGGGGAAAGCGGGCGGAGGCGGG - Intronic
1165475360 19:36027099-36027121 TGGGGAAACCAGGGGGAGAGGGG - Intronic
1165900548 19:39167438-39167460 CAGGGCCACCAGGGGTGGGCTGG + Intronic
1165951375 19:39475583-39475605 CTGGGACCCCAGGGGGAGGTTGG + Intronic
1166937057 19:46340264-46340286 CAGGCAAAGCTGGGGGCGGCAGG - Exonic
1167002392 19:46753707-46753729 CCAGGAGACCAGGGGGAGGTTGG + Intronic
1167108187 19:47443282-47443304 TATGGTAACCAGGGGGTGGCAGG + Intronic
1167597646 19:50435865-50435887 GAGGGGAACCCGGGGGAGGAGGG + Intronic
1167608009 19:50492145-50492167 CAGGGAGAGGAAGGGGAGGCAGG + Intergenic
1168314627 19:55479216-55479238 CCCGGAGGCCAGGGGGAGGCGGG + Intronic
925073214 2:987714-987736 CTAGGAAACCAAGGGGAGGCTGG + Intronic
925295196 2:2771881-2771903 CATGGAAACCTGTGTGAGGCTGG + Intergenic
925302774 2:2828792-2828814 CAGGCAGACCAGAGGGAGACAGG + Intergenic
925386084 2:3462804-3462826 CAGGGGCACCCGGGGGAGGGGGG - Intronic
925484602 2:4313811-4313833 AAGAGAAAACAGGGGGTGGCTGG - Intergenic
925663165 2:6224273-6224295 CAGGAAAAACAAGGGGAGACAGG + Intergenic
926142662 2:10377604-10377626 CACGGGAGCCAGGGGGAGGAGGG - Intronic
926358404 2:12062550-12062572 CAGGGGAACCTGGCAGAGGCAGG - Intergenic
926511189 2:13781529-13781551 CAGGGAGAGAAAGGGGAGGCAGG - Intergenic
926973033 2:18485688-18485710 CAGGGAAACCTGGGGAAGGAGGG - Intergenic
927451100 2:23210126-23210148 CATGGAAAACAGTGGGAGCCAGG - Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
928249290 2:29660615-29660637 GAGGGAAACCAGGAGAAGGTGGG + Intronic
928922500 2:36540107-36540129 CATGGAAACCAGGTGGAGAAAGG + Intronic
929609277 2:43257917-43257939 CAGAGAAGCCAGTGGGAGGAAGG + Intronic
929611914 2:43277055-43277077 CAGGGAAATCAGCTGGGGGCTGG - Intronic
929720011 2:44358631-44358653 CAGGGACAACAGGTGTAGGCTGG + Intronic
929824936 2:45302670-45302692 CTGGGAAATCAGTGGGAAGCAGG + Intergenic
929829478 2:45335429-45335451 AAAGGAAACCTGGAGGAGGCTGG + Intergenic
929942862 2:46348068-46348090 GAGGGAATCCAGTGTGAGGCTGG + Intronic
930106087 2:47640563-47640585 AAGGGAAATCAGCGTGAGGCAGG + Intergenic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
932283745 2:70515782-70515804 CAAGAAAACCTAGGGGAGGCAGG + Intronic
932696489 2:73961185-73961207 CAGGGAAACTTGGGGGAGATGGG - Intergenic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
933899372 2:86838054-86838076 CATGGAAATCACGGTGAGGCAGG - Intronic
933979457 2:87538539-87538561 CAGGGGGACGAGGGGGCGGCTGG - Intergenic
934614657 2:95763737-95763759 CAGGGAAAACAGGGGTGGCCTGG - Intergenic
934646247 2:96060759-96060781 CAGGGAAAACAGGGGTGGCCTGG + Intergenic
934839650 2:97616841-97616863 CAGGGAAAACAGGGGTGGCCTGG + Intergenic
934920404 2:98339853-98339875 CAGGCAAGCCTGGGGGAAGCAGG + Intronic
935781190 2:106511174-106511196 CATGGAAATCACGGTGAGGCAGG + Intergenic
936291306 2:111225975-111225997 AAGGGGAACCAGTGGGAGGGAGG + Intergenic
936314366 2:111412252-111412274 CAGGGGGACGAGGGGGCGGCTGG + Intergenic
936444955 2:112587917-112587939 CAAGGAGACCAGAGAGAGGCTGG - Intronic
937225470 2:120366378-120366400 CAGGGCAGCGAGGGGCAGGCAGG + Intergenic
937264618 2:120608003-120608025 CAGGGAACCCAGGGGGGCTCAGG + Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938313585 2:130311269-130311291 CAGGGAATCCAGAGGGAGTGAGG - Intergenic
938671321 2:133589135-133589157 CAGAGAAACCAAGGGGACACAGG + Intergenic
938732695 2:134158685-134158707 CAGGGCAGCCAGCGGGAGACGGG - Intronic
939983763 2:148811122-148811144 CAGGGAACCCAGAGGATGGCAGG - Intergenic
941683884 2:168428119-168428141 CAGGGAGACCTGGGGGAGAGGGG + Intergenic
941911742 2:170770943-170770965 CCGGGGAACCACGGAGAGGCAGG - Intergenic
946023822 2:216659927-216659949 CAGTGACAGCAGGGGGATGCTGG + Intronic
946777150 2:223155291-223155313 CAGGGAAACCATAGAGAGGGGGG - Intronic
947232634 2:227903373-227903395 AAAGGAAAGCAGGTGGAGGCTGG + Intronic
947713679 2:232329621-232329643 CAGGGAGACCATGGGGGTGCTGG + Intronic
948826954 2:240577496-240577518 CTGGGAAGCCAGGGGCAGGAGGG + Intronic
948866441 2:240777456-240777478 CAGGAAACCCAGGGGGCTGCTGG - Intronic
949020946 2:241741105-241741127 CAGGGAAGGCTGGGGGAGCCGGG - Intronic
1169068199 20:2706314-2706336 CACTCAGACCAGGGGGAGGCAGG - Intronic
1169120958 20:3095293-3095315 CTGGGAGGCCAGGGGCAGGCTGG - Intergenic
1169783102 20:9330189-9330211 CTGGGAAAGCAGGTGGAGTCTGG - Intronic
1169806255 20:9562511-9562533 CAAGGATACCAGGGGAAGGAAGG - Intronic
1169949889 20:11032224-11032246 CTGGGAAACCAGTGGGATGGTGG + Intergenic
1170480659 20:16761866-16761888 CAGGGGCACCATGGGGTGGCTGG + Intronic
1170787778 20:19482327-19482349 CAGAGAAGCCTGGGGGAGGGAGG - Intronic
1170907517 20:20529072-20529094 CACGGAAACTAGAGGGAGGCAGG + Intronic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1171466190 20:25329409-25329431 CAGTGAAAACTGGGGGAAGCAGG - Intronic
1171810970 20:29743919-29743941 CAGGGACACCTGGGGAAGGGAGG + Intergenic
1172180607 20:33001184-33001206 CAGGGAAGGCAGGGGGAGGGTGG - Intronic
1172311078 20:33918887-33918909 CAGGGAGGCCAGGGAGGGGCTGG - Intergenic
1172759555 20:37312413-37312435 CCAGGAAACCTGGGAGAGGCTGG + Intronic
1172846099 20:37930771-37930793 CAGGGCACCCAGGGTGAGGTGGG - Intronic
1172980148 20:38935382-38935404 CAGGGCCACCAGAGGGTGGCAGG - Intronic
1173260844 20:41433983-41434005 CATGTAAACCAGAGGAAGGCAGG + Intronic
1173574266 20:44100535-44100557 CAGGTAGACCAGGGGAAGGGAGG + Intergenic
1173873956 20:46358179-46358201 CAGGGAAACCAAGGAGAGCGGGG - Intronic
1174450746 20:50618591-50618613 CAGGGTAAGCAGGCAGAGGCAGG - Intronic
1175141644 20:56865060-56865082 ATGGAAAAGCAGGGGGAGGCTGG + Intergenic
1175170767 20:57079892-57079914 CAGGGAAGGAAGGGGGAGGCAGG - Intergenic
1175275794 20:57769917-57769939 CAGGGACTCCAGGGGGATTCCGG - Intergenic
1175294679 20:57900241-57900263 GAGGGAAACGAGTGGGAGGAAGG - Intergenic
1175824668 20:61930488-61930510 CAGGGATCCCAGTGGGAGGCAGG + Intronic
1175968782 20:62673463-62673485 CAGTGACACCCGGAGGAGGCAGG - Intronic
1176002579 20:62839674-62839696 CAGGGCACCCAGGGAGAGGTGGG - Intronic
1176002597 20:62839722-62839744 CAGGGCACCCAGGGAGAGGTGGG - Intronic
1176002615 20:62839770-62839792 CAGGGCACCCAGGGAGAGGTGGG - Intronic
1176375485 21:6085137-6085159 CTGGGAACCCTGGGGGAAGCAGG + Intergenic
1177296395 21:19181779-19181801 CAGGGAACCCAGGAGGGTGCTGG - Intergenic
1178075343 21:29010661-29010683 GAGGGAGACCATGGGGAGACGGG - Intronic
1178255459 21:31048200-31048222 CAGTGAAAGCAGGAGAAGGCTGG + Intergenic
1179146171 21:38769744-38769766 TAGGTAAGCCAGGGGCAGGCTGG - Intergenic
1179581650 21:42348098-42348120 CAGGGAAACCAGGCAGATGGTGG - Intronic
1179608801 21:42535654-42535676 CAGGGAAGCCAGTGGCAAGCGGG - Intronic
1179612549 21:42561848-42561870 CAGGGGCACCAGGGAGGGGCGGG - Intronic
1179747989 21:43453107-43453129 CTGGGAACCCTGGGGGAAGCAGG - Intergenic
1181106910 22:20581119-20581141 CTGGGAGACCAGGGGGTGGGGGG - Intronic
1181236031 22:21448172-21448194 CAGGGGAACCATGAGGAGGGTGG + Exonic
1181443212 22:22949284-22949306 CAGGGCAACCAGGGGCAGGGTGG + Intergenic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1182282281 22:29224538-29224560 AATGAAAACCAGAGGGAGGCTGG - Intronic
1182356565 22:29724854-29724876 GAGGGGAGCCAGGGGAAGGCAGG - Intronic
1182421126 22:30249060-30249082 CATGGACAGGAGGGGGAGGCTGG - Intergenic
1182453061 22:30432623-30432645 CAGGGAAATAAGGGGGGGGCGGG - Intergenic
1182679123 22:32064569-32064591 AGGGGAAACTAGGGGAAGGCAGG - Intronic
1182772626 22:32806186-32806208 GAGGAAAGCCAGGGGGAGTCAGG + Intronic
1183230697 22:36580224-36580246 CTTGGACACCAGTGGGAGGCAGG - Intronic
1183528130 22:38336283-38336305 CCGGGAAACCGGGGCGGGGCGGG - Intronic
1184003798 22:41694334-41694356 AATAGAAACCAGAGGGAGGCTGG + Exonic
1184188400 22:42879295-42879317 CTGGGAAACCAGGGAGAGCTGGG - Intronic
1184196807 22:42935294-42935316 AAGGGAAACAGGGAGGAGGCAGG - Intronic
1184413526 22:44339139-44339161 CAGGGAAACACTGGGGAGGGGGG - Intergenic
1184691722 22:46120285-46120307 CAGGGAGCCCAGAGCGAGGCTGG + Intergenic
1184826616 22:46956963-46956985 CAAGGAACCCAGGGAAAGGCTGG + Intronic
1185130005 22:49033492-49033514 TAGGGAAACCAGGGAGAGAGGGG - Intergenic
1185158584 22:49208892-49208914 CAGGGAAGCAAGGGAGCGGCGGG + Intergenic
949360071 3:3222154-3222176 CAGGGAACCGAAGAGGAGGCAGG + Intergenic
949538862 3:5016771-5016793 CAGTGAACCCAGGGTGAGTCAGG + Intergenic
949836094 3:8271722-8271744 CAGTGAAACAAAGGTGAGGCTGG - Intergenic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950525914 3:13523184-13523206 CACGGGAAGCAGGGGGAAGCTGG - Intergenic
950580077 3:13856162-13856184 CAGGGACACCATGGGTGGGCTGG - Intronic
950640257 3:14344054-14344076 CCGGGAGCCCAGGGGGAGGCTGG + Intergenic
950670394 3:14522229-14522251 CTGAGAAACCAGGGTGAGGGTGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951520838 3:23609420-23609442 CAGTGAAATTAGGGAGAGGCAGG + Intergenic
951536968 3:23749169-23749191 CAGGGACAACAGGGGTATGCAGG - Intergenic
952199335 3:31110271-31110293 CAGGGTAAGCAGGGGTATGCTGG + Intergenic
952312624 3:32203874-32203896 CAGTGAAACCAGGGAAAGGAAGG - Intergenic
952655073 3:35776420-35776442 CAGGGAAAGCAGAGGAAGGGTGG + Intronic
952882100 3:37991514-37991536 AAGAAGAACCAGGGGGAGGCAGG + Intronic
953750836 3:45607267-45607289 CAGGGAAACCAGCTGGACACAGG + Intronic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
954115311 3:48463879-48463901 CAGGTAAAGCAGGGTGGGGCGGG + Exonic
954412780 3:50378240-50378262 CAGGGAAGCCAGGGGCTGGGAGG + Intronic
955732093 3:61997792-61997814 CAGGGAAATTAGTGGAAGGCTGG + Intronic
960284370 3:115810718-115810740 CAGGGCCAACAGGAGGAGGCTGG - Intronic
960963545 3:123089346-123089368 CAGGGGAAGGAGTGGGAGGCAGG + Intronic
961147091 3:124603328-124603350 CAAGGCTACCAGGAGGAGGCAGG - Intronic
961210352 3:125120616-125120638 CAGGGAGCCCAGGGGAATGCTGG + Exonic
961335274 3:126172835-126172857 CAGTGAAGCCAGGGAGAGGCAGG + Intronic
961827587 3:129606891-129606913 CAGGGCGGCCAGGGGCAGGCGGG - Intergenic
961872059 3:129995853-129995875 CAGGGAAGCCATGGGAAGGGTGG + Intergenic
962960537 3:140307333-140307355 CAAGGAGAGCAGGAGGAGGCCGG - Intronic
963043287 3:141084478-141084500 CAGGGCAGGCAGGGGGAGGGGGG - Intronic
963049333 3:141128084-141128106 CAGGGAAACCTGGAGGCCGCAGG - Intronic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
965179476 3:165383574-165383596 AAGTGAAAGCAGGGGGAAGCAGG + Intergenic
965376511 3:167930971-167930993 TAGGGCTACTAGGGGGAGGCAGG + Intergenic
965384429 3:168029225-168029247 CAGGGAATCCAAGGAGAGGAAGG - Exonic
965827568 3:172746120-172746142 CAGGGAGACCAAGAGGAGGAAGG + Intergenic
966595155 3:181719429-181719451 CAGGGCAGCCGGCGGGAGGCCGG - Intergenic
967846241 3:194045313-194045335 AAGGTAAACCAGGGAGAGCCCGG - Intergenic
967993726 3:195151078-195151100 CAGGGAAACCAGGGTAAGAGAGG - Intronic
968137629 3:196230385-196230407 CTAGGAAACTAGGGAGAGGCTGG - Intronic
968467855 4:761870-761892 CAGTGACACCATGGGGATGCAGG + Intronic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968704619 4:2072164-2072186 CAGGGGACCCAGGGGCAGCCAGG + Exonic
969120275 4:4903521-4903543 CAGGGAAGCCAAGGGGTTGCTGG + Intergenic
969161873 4:5267364-5267386 CAGGGAAAGCGGGGAGGGGCAGG - Intronic
969163290 4:5280434-5280456 CAGGGAGACGAGGGAGAGTCAGG - Intronic
969186587 4:5479021-5479043 AAGCGGATCCAGGGGGAGGCAGG + Intronic
969329822 4:6467882-6467904 CAGGGAAACCTTGTGGTGGCTGG - Intronic
969340001 4:6534745-6534767 CAGGGCAGCCATGCGGAGGCGGG - Intronic
969465469 4:7353726-7353748 CAGGGAGCCCAGGGGCTGGCTGG + Intronic
969519230 4:7666128-7666150 CAGGAGACTCAGGGGGAGGCAGG + Intronic
969576556 4:8039346-8039368 CAGGGAAGCCTGAGGAAGGCTGG - Intronic
969689109 4:8694554-8694576 CAGGGAGAGCAGGTGGAGGAAGG + Intergenic
972690229 4:41389930-41389952 AAGGTAAACCATGGGGAGCCAGG - Intronic
973774079 4:54229922-54229944 CTGGGGGACCAGGGGGAGGTGGG + Intronic
973975643 4:56259767-56259789 CAGGCAAAGCAGGGGGTTGCTGG + Intronic
974499247 4:62677506-62677528 GAGAGAAACAAGAGGGAGGCTGG - Intergenic
975923175 4:79417357-79417379 CCGTGAAACCAGGGGTCGGCAGG - Intergenic
976595156 4:86888889-86888911 CAGGTAAACAAAGGGGTGGCTGG - Intronic
977724707 4:100282379-100282401 CAGGTAAACGATGGGGAGGATGG + Intergenic
979573545 4:122258744-122258766 CAGAGCTACCAGGTGGAGGCCGG - Exonic
982066649 4:151660240-151660262 GAGGGAGACCAGGGGCTGGCTGG - Intronic
984320531 4:178190200-178190222 CAGGGAAAAGAAGGGGACGCAGG + Intergenic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
984708125 4:182862728-182862750 CAGGGAAGGCTGGGGGTGGCAGG - Intergenic
985544994 5:504999-505021 CAGGGAAAGCAGGGGAGGGGTGG - Intronic
986222030 5:5776519-5776541 CAGGGCAACCCTGGGGAGACAGG + Intergenic
988497710 5:31758910-31758932 CAGGGAACGCATGTGGAGGCGGG - Intronic
989236724 5:39156426-39156448 CAGCAAAACCAGAGGGAAGCAGG + Intronic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989534714 5:42550374-42550396 CAGGGGAACCTTGGGGAGGCAGG - Intronic
991163476 5:63533044-63533066 CAGGGAAAACTAGAGGAGGCTGG - Intergenic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
992880708 5:81106526-81106548 CAGAGAAATCAGTTGGAGGCAGG - Intronic
993680843 5:90875552-90875574 CAAGGAAACCAGGTGGTGGTGGG + Intronic
994134958 5:96275551-96275573 CAGGGAAAGGAGGTGGAGACAGG - Intergenic
995935103 5:117501470-117501492 AAGGAAAACCAGTGGTAGGCTGG - Intergenic
997293550 5:132755045-132755067 CCAGGAAGCCAGGGGGAGGAGGG - Intronic
997365057 5:133320319-133320341 CAGTGAAACCAGCAGGGGGCAGG - Intronic
997748447 5:136320633-136320655 CAGGGAGAAAATGGGGAGGCTGG - Intronic
997980197 5:138464100-138464122 CAGGGACTGCAGGGGGAGCCCGG + Intergenic
998583742 5:143404697-143404719 TAAGGAAAGCAGGGGGCGGCAGG + Intronic
999326911 5:150649497-150649519 CAGAGGGACCAGGGGGAGGTAGG + Exonic
1000254935 5:159528652-159528674 CAGAGGTACCAGGGGCAGGCTGG + Intergenic
1001079997 5:168660696-168660718 CAGGGAGACCTGGGGGAAGAAGG + Intergenic
1001321617 5:170687018-170687040 CAGGGAACTCAGGGGGAGAATGG - Intronic
1002058283 5:176610741-176610763 GAGGGTATCCAGGGGGAGGGGGG - Intergenic
1002095504 5:176828519-176828541 CAGGGAAGCCAGGGGAAGATGGG - Intronic
1002099925 5:176852443-176852465 CAGGGAAAACTGGGGAAGGAAGG - Intronic
1002169336 5:177366681-177366703 GAGGGGAAGGAGGGGGAGGCAGG - Intronic
1002426697 5:179180943-179180965 CAGGGGAGCCAGGGAGAGGCAGG + Intronic
1002518693 5:179777934-179777956 CAGGGCAGCCTGGGAGAGGCTGG + Intronic
1002689232 5:181038698-181038720 CAGGGAAGCCATGGGCAGCCCGG - Intergenic
1002821977 6:734419-734441 CCAGGAAGCCAGGGGGTGGCTGG + Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1002968299 6:1989782-1989804 CAGGGAAGGCAGGGCCAGGCTGG - Intronic
1003079037 6:3006144-3006166 CGGGGAAAACTGGGGAAGGCAGG + Intronic
1004975508 6:20961439-20961461 GAGGGAGATCAGGGGGAGGTGGG + Intronic
1005665840 6:28053417-28053439 CAGGGAAACCACTGTGAGGTGGG + Intergenic
1005917346 6:30364796-30364818 CAGGGAGACCAGGAGGTGGCAGG + Intergenic
1006294508 6:33164168-33164190 CAGGGCACCCAGGGGGAGCAGGG - Intronic
1006303605 6:33206870-33206892 AAGGGAAAGGAGGGGGAGGTGGG - Intergenic
1006341282 6:33448546-33448568 GAGGGAGGCCAGAGGGAGGCTGG - Intronic
1006397455 6:33796596-33796618 CAGGGAGCCCGGTGGGAGGCAGG - Intronic
1006505481 6:34486178-34486200 CTGGGAACCCAGGGAGAGGGAGG + Intronic
1006632083 6:35436804-35436826 CAGGGAAACACAGGGGAGGTGGG + Intergenic
1006720625 6:36147748-36147770 CAGGGAAACAAGGCAGAGGCAGG - Intergenic
1007956125 6:45919363-45919385 CAGAGTAACCATGGGGATGCTGG + Intronic
1007966605 6:46009122-46009144 GAGGTAAACCATGGGTAGGCTGG - Intronic
1008627843 6:53335332-53335354 CAGGGAAGCCAGAGGGAGACAGG - Intronic
1010326016 6:74562551-74562573 CTGAGAAACCAGGGGGCAGCTGG + Intergenic
1012553080 6:100482016-100482038 CAGGGACTCCAGAGGGAAGCGGG + Intergenic
1012637937 6:101570470-101570492 CAGGGGGAGAAGGGGGAGGCTGG - Intronic
1015478038 6:133675502-133675524 TAGGGAAAGCAGGGAGATGCCGG + Intergenic
1017520045 6:155194177-155194199 CAGAGAAGCCGGGAGGAGGCCGG + Intronic
1018623228 6:165751542-165751564 CAAGGCAACCAGGTGGAGGTAGG + Intronic
1019160996 6:170066738-170066760 CAGAGAAACTCTGGGGAGGCAGG - Intergenic
1019361399 7:605987-606009 GAGGGAAACAAGGGTGATGCTGG - Intronic
1019485046 7:1285563-1285585 CAGGGACAACTGGGGGAGGAGGG - Intergenic
1019534925 7:1523866-1523888 CAGGGTAACCCGGGGGACTCAGG - Intergenic
1020280260 7:6646702-6646724 CAGGGAGCACTGGGGGAGGCGGG - Intronic
1021505957 7:21385349-21385371 CAGGTATAACAGAGGGAGGCAGG - Intergenic
1022785585 7:33634164-33634186 CAGGCACTCCTGGGGGAGGCAGG - Intergenic
1023230242 7:38020236-38020258 CTGGGAAACCAGAGAGAGCCCGG - Intronic
1024617863 7:51130654-51130676 GAGGACACCCAGGGGGAGGCAGG - Intronic
1025010014 7:55388963-55388985 TAGGGAAACCTGGAGGGGGCTGG + Intronic
1025020617 7:55476685-55476707 CAGGGAAGCCAGGGCATGGCTGG - Intronic
1025230969 7:57203201-57203223 CAGGGAGACCAGGGGGAACCAGG - Intergenic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1027853481 7:83479207-83479229 CAGAGAAAGCAGGGGTAGGAAGG - Intronic
1027858135 7:83539199-83539221 CTGGGAGCCCAGGGGGAAGCTGG + Intronic
1029790389 7:102837288-102837310 CAGGGAAACCAGGCTGAGCAAGG + Intronic
1030735533 7:113043495-113043517 CAGGGAGCCCAAGGGGAGGGAGG + Intergenic
1030942476 7:115671222-115671244 AAGGGAAACCAGGGGCACGTGGG - Intergenic
1031993170 7:128211004-128211026 TGGGGAAGCCAGGGGGAGCCAGG + Intergenic
1032384037 7:131509209-131509231 CAGGCTAACCAGGGAGAGGGAGG + Intronic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1032551404 7:132787489-132787511 CAGGGAAGTCAGTGGGAGCCTGG + Intronic
1033551477 7:142451819-142451841 CAGGGTCACCAGGGAGAGACGGG - Intergenic
1034267095 7:149786319-149786341 GAGGGAGACCAGGAGGAGGGAGG - Intergenic
1034381271 7:150695691-150695713 TATGGAAACCAGGTGGAGCCTGG + Intergenic
1034843562 7:154422228-154422250 CAAGGAAATCAGGTTGAGGCTGG + Intronic
1034849454 7:154480238-154480260 CAGGGAAGCCAGGCCGAGCCAGG - Intronic
1035037381 7:155904037-155904059 CAGGGACACCAGGGGAGGGATGG + Intergenic
1035100069 7:156389244-156389266 CAGGGACACCAGCTGGAGGAAGG - Intergenic
1036588258 8:10144999-10145021 AAGGAAAAGCAGGGAGAGGCGGG - Intronic
1038320244 8:26519126-26519148 CATGGAAATCAGGGTGAGGCTGG + Intronic
1038455828 8:27671291-27671313 CCGGGAGACCAGGGGGACCCTGG - Exonic
1039407544 8:37326286-37326308 GAGGGAAGCCAGTGGGAGGAAGG - Intergenic
1039579367 8:38651228-38651250 GAGGGAGGCCAGGAGGAGGCCGG - Intergenic
1039893199 8:41698089-41698111 CAGGGAATCCTGGGGATGGCTGG + Exonic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1040536689 8:48316746-48316768 CAGGAAAACCAGGGTATGGCAGG + Intergenic
1040804788 8:51382236-51382258 CAGGGAAACCAAGGGTTGCCGGG + Intronic
1040875076 8:52142245-52142267 CAGAGAATCCAGGTGGAAGCTGG + Intronic
1042494336 8:69439316-69439338 AAGGGAAATCAGGGTGGGGCAGG + Intergenic
1042807664 8:72789509-72789531 CAGGTAGAGAAGGGGGAGGCAGG + Intronic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1044824531 8:96183657-96183679 CAGGGAGACCAAGGCGTGGCTGG - Intergenic
1044855390 8:96470021-96470043 CAGGGTAACCAGGGACAGCCTGG + Intergenic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1045501756 8:102749015-102749037 CAGGGATCCCAGAGGGAAGCAGG + Intergenic
1046195603 8:110859991-110860013 CAGTGGAGCCAGGGGGAGCCAGG + Intergenic
1046547357 8:115668677-115668699 GAGGGAAAGGGGGGGGAGGCAGG - Exonic
1048163947 8:132045553-132045575 AAGGGAAACCAGGAGAAGGCAGG - Intronic
1048229092 8:132619684-132619706 AAGGAAAACCAGGGGAAGGGAGG + Intronic
1048904466 8:139074607-139074629 CAGGCAATACAGGGTGAGGCTGG - Intergenic
1048959421 8:139563442-139563464 CATGGAAACCAGTGACAGGCAGG + Intergenic
1049260732 8:141637713-141637735 TAGGGAGAGCAGGTGGAGGCAGG + Intergenic
1049444670 8:142624487-142624509 CAGGGCATCCAGACGGAGGCTGG + Intergenic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049601129 8:143508178-143508200 CAGGAAAACCAGGAGAAGCCAGG + Intronic
1049687360 8:143944297-143944319 TGGGGACAGCAGGGGGAGGCTGG - Intronic
1049738674 8:144223522-144223544 CTGAGAAACCAGAGGGAGCCAGG - Intronic
1050441545 9:5669279-5669301 CAGGGAAAAGGGTGGGAGGCGGG - Intronic
1050905125 9:10993987-10994009 AAGGGAAACGGGGGGGGGGCGGG + Intergenic
1051374113 9:16386883-16386905 CAGAGAGACCAGCAGGAGGCAGG + Intergenic
1051746196 9:20297428-20297450 GATGGAAACCAGGGGAAGGTGGG + Intergenic
1053054985 9:34988833-34988855 CAGGCACTCCAGGGGGAAGCAGG + Intergenic
1053506006 9:38643726-38643748 TCGGGAAACCAGGGAGATGCAGG + Intergenic
1055307705 9:74947378-74947400 CTGGGAAAACAGGGGGAAGCAGG + Exonic
1055449061 9:76414508-76414530 CAGAGCAACCAGGGGGCTGCTGG + Intergenic
1055734386 9:79312183-79312205 CAGTGATACAAGAGGGAGGCCGG + Intergenic
1057129752 9:92645679-92645701 CATGGAGGCCAGGAGGAGGCAGG + Intronic
1057174367 9:92985221-92985243 TAGGGAAACCTGGAGGAGGCTGG + Intronic
1057292356 9:93814717-93814739 CAGGGAAACCAGAGAGAGAGAGG - Intergenic
1057390731 9:94639694-94639716 CAGGAAGACTAGGGGGCGGCAGG - Intronic
1057565657 9:96164114-96164136 CTGGGACACCAGGGAGGGGCTGG - Intergenic
1058375327 9:104316152-104316174 CAGGAGAACCATGGGGAGCCCGG - Intergenic
1058742641 9:107959204-107959226 CAGGTAGACCAAGGGGTGGCTGG - Intergenic
1058907492 9:109493785-109493807 AAAGGCAGCCAGGGGGAGGCCGG + Intronic
1059438995 9:114292172-114292194 CCTGGAAACCAGGGGGAGCCTGG + Exonic
1060485251 9:124042343-124042365 CAGGGCCAGGAGGGGGAGGCAGG - Intergenic
1060929096 9:127477221-127477243 GAGGGGAACCAGGGTTAGGCTGG + Intronic
1061004273 9:127919598-127919620 CAGGGAAACTCGGAGGTGGCAGG - Intergenic
1061034463 9:128105993-128106015 CAGGGACAGCAGGGCGAGGCAGG + Intronic
1061400869 9:130367643-130367665 TAAGGATCCCAGGGGGAGGCTGG + Intronic
1061739579 9:132691118-132691140 TGTGGAAACCTGGGGGAGGCAGG - Exonic
1061859543 9:133460791-133460813 CAGAGGACCCAGGGAGAGGCCGG - Intronic
1062074100 9:134575125-134575147 CAGGGAAACCATGGAGGTGCTGG + Intergenic
1062109580 9:134774582-134774604 CAGGGAAATAAGGGATAGGCTGG - Intronic
1062295814 9:135825936-135825958 CAGGGAGCCCGGGGGGAAGCTGG + Intronic
1062337600 9:136079244-136079266 GGGGGAGACCAGGGAGAGGCAGG + Intronic
1062424611 9:136500335-136500357 CAGGGAAGTCAGGCAGAGGCGGG - Intronic
1062533593 9:137012101-137012123 CAGGTAATCCAGGGAGAGGCTGG + Exonic
1062609642 9:137368238-137368260 CAGGGACTCAAGGGGGTGGCTGG + Intronic
1186361963 X:8851782-8851804 TCAGGAAACCAGAGGGAGGCCGG + Intergenic
1189089881 X:38070509-38070531 GAGAGAAACCAGAGGTAGGCAGG - Intronic
1190282610 X:48940878-48940900 CAGGGGAACCAATGGCAGGCAGG + Intronic
1192879988 X:75273836-75273858 CAGGAAAAACTGGGGGTGGCAGG - Intergenic
1193277184 X:79602821-79602843 CAGGGTAACCAAGGGTTGGCTGG + Intergenic
1195282585 X:103350350-103350372 CAGGAAACTCAGGAGGAGGCTGG + Intergenic
1195476914 X:105297508-105297530 CAGGGAGGCGAAGGGGAGGCAGG + Intronic
1195479296 X:105324335-105324357 CAGAAAAAGCAGGGGAAGGCTGG - Intronic
1195986283 X:110634154-110634176 AAGGGAAATCAGGGGGTGGAGGG + Intergenic
1196130134 X:112146590-112146612 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196130138 X:112146609-112146631 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1197230556 X:123999432-123999454 CAGGGAGAGAAGGGGGAGGGAGG - Intronic
1197713188 X:129686935-129686957 TAGGGAAACAATGGGCAGGCTGG - Intergenic
1198499931 X:137233749-137233771 GAGGGAAATCAGGGGAAGGCAGG - Intergenic
1199321172 X:146440990-146441012 AAGAGAAAACAGGGGGAGGAAGG + Intergenic
1199685655 X:150263053-150263075 CACGGCAACCAGGTGGAGGCAGG - Intergenic
1200194752 X:154240186-154240208 CAGGGAAAGAAGAGGAAGGCAGG + Intergenic
1200230011 X:154439162-154439184 CAGAGAAATCATGGGGTGGCAGG + Intronic
1201774504 Y:17648520-17648542 CAGGGAAACCCCTGGGAGGGCGG + Intergenic
1201827052 Y:18257469-18257491 CAGGGAAACCCCTGGGAGGGCGG - Intergenic