ID: 1049565641

View in Genome Browser
Species Human (GRCh38)
Location 8:143337096-143337118
Sequence TCCAGTCCGTGAACATGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049565641_1049565647 18 Left 1049565641 8:143337096-143337118 CCATCCCATGTTCACGGACTGGA 0: 1
1: 0
2: 3
3: 26
4: 143
Right 1049565647 8:143337137-143337159 ACAGCATTGGCCAGGTGCAGTGG No data
1049565641_1049565645 5 Left 1049565641 8:143337096-143337118 CCATCCCATGTTCACGGACTGGA 0: 1
1: 0
2: 3
3: 26
4: 143
Right 1049565645 8:143337124-143337146 TCATATGGTTAAGACAGCATTGG No data
1049565641_1049565646 10 Left 1049565641 8:143337096-143337118 CCATCCCATGTTCACGGACTGGA 0: 1
1: 0
2: 3
3: 26
4: 143
Right 1049565646 8:143337129-143337151 TGGTTAAGACAGCATTGGCCAGG No data
1049565641_1049565644 -10 Left 1049565641 8:143337096-143337118 CCATCCCATGTTCACGGACTGGA 0: 1
1: 0
2: 3
3: 26
4: 143
Right 1049565644 8:143337109-143337131 ACGGACTGGATGATTTCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049565641 Original CRISPR TCCAGTCCGTGAACATGGGA TGG (reversed) Intronic
904499818 1:30907636-30907658 TCCCGTCCGTGGTCGTGGGAGGG - Intronic
906577759 1:46905962-46905984 TCCAGACTGTGAGTATGGGAAGG + Intergenic
908537824 1:65094672-65094694 TCCAATCCATAAGCATGGGATGG + Intergenic
915493101 1:156262606-156262628 TCCAGTATGGGCACATGGGAGGG - Intronic
918272690 1:182918526-182918548 TCCAATCCATGAACATGGGATGG - Intronic
920025944 1:202996553-202996575 TCCAATCAATGAACATAGGATGG - Intergenic
920892129 1:209998321-209998343 TCCAATCCATGAGCACGGGATGG - Intronic
921042255 1:211444525-211444547 TCCAATCCATGAACATGGGGTGG - Intergenic
922485792 1:225972269-225972291 TCCAGTCCCTGAGCATGGGAAGG + Intergenic
923656372 1:235920708-235920730 TCCAGTCACTGGACCTGGGAGGG - Intergenic
924192906 1:241573887-241573909 TCCAATCCATGAACTTGGAATGG + Intronic
1062933849 10:1370823-1370845 TCCAATCCATGAGCATGGGATGG - Intronic
1062934061 10:1373009-1373031 TCTATTCCATGAGCATGGGATGG - Intronic
1063186836 10:3659448-3659470 TGCAGTCCGGGAACATGGCGGGG + Intergenic
1063625272 10:7683483-7683505 TCCAATCCATGAGCATGGAATGG - Intergenic
1064619334 10:17199171-17199193 TCAAATAAGTGAACATGGGAAGG + Intronic
1065054196 10:21827068-21827090 TCCAATCCATGAACATAAGACGG + Intronic
1065405805 10:25362567-25362589 TTCAATCCATGAACATGGGATGG + Intronic
1066132908 10:32411753-32411775 ACCAGACTGTGAACATGGGCTGG - Intergenic
1068270943 10:54722915-54722937 TCCAATCCATGAGCATAGGATGG - Intronic
1070234040 10:74604866-74604888 TCCTATCCGTGAGCATGGAATGG + Intronic
1073831881 10:107394057-107394079 TCCAGTCAGTGAACATTAGCGGG + Intergenic
1076760356 10:132602087-132602109 TCCAGTTTGTGAACATGGAATGG + Intronic
1076835092 10:133016954-133016976 TCCAGTCCTTGAGCCTTGGAGGG - Intergenic
1077033507 11:481471-481493 GTCAGTCCTTGAAGATGGGATGG + Intronic
1079549707 11:21679321-21679343 TTCAATCCATGAACTTGGGATGG + Intergenic
1080915346 11:36652172-36652194 TCCTATCCATGAACATGGAATGG + Intronic
1081966248 11:47171851-47171873 TACAGTGCCTGAACCTGGGAGGG - Intronic
1083772635 11:64877096-64877118 TGGAGTCCGTGAACGTGGGGTGG + Intronic
1086649014 11:89263863-89263885 TCCAATCTGTGAACAAGGGGGGG - Intronic
1089900751 11:121981329-121981351 TCCAATGCATGAACATGGCATGG - Intergenic
1091342927 11:134833408-134833430 TCCGGTCCATAATCATGGGATGG - Intergenic
1093082200 12:14825447-14825469 TCTAGGCTGTGAGCATGGGATGG + Intronic
1095218955 12:39585140-39585162 TCCTATCCATGAACATGGGATGG + Intronic
1095542621 12:43328715-43328737 TCCTATCCATGAGCATGGGATGG + Intergenic
1095780560 12:46054482-46054504 TCCAATCCATGAACATGGAAAGG - Intergenic
1098624657 12:72648919-72648941 TCCAATCCATGAACATCAGATGG - Intronic
1099394381 12:82120371-82120393 TCCAATCCGTGAGCATGAAATGG - Intergenic
1100931786 12:99618311-99618333 TTCAATCCATGAACATGGAATGG - Intronic
1103022210 12:117543661-117543683 TCCAATCCATGAACATGGTATGG + Intronic
1103141918 12:118556093-118556115 TCCACACCTTGAACATGGGTTGG - Intergenic
1103522864 12:121548015-121548037 TCAAGTCCTTGAACATGGAGGGG + Intronic
1103930202 12:124446051-124446073 TCCAGTGCTGGGACATGGGAAGG - Intronic
1104397707 12:128448622-128448644 CCCATTCCATAAACATGGGATGG - Intronic
1105653970 13:22414246-22414268 TCTGATCCATGAACATGGGATGG + Intergenic
1106278741 13:28242777-28242799 TCCAATCTGTGAACATGGATGGG + Intronic
1106936664 13:34729930-34729952 ACCACTCCTTGAACATGGGCTGG + Intergenic
1107116229 13:36748852-36748874 TCCTATCCATGAACATGGAATGG + Intergenic
1112021518 13:95375371-95375393 TACAATCCATGATCATGGGATGG - Intergenic
1112061516 13:95744081-95744103 TCCAGTGCATGAACATAGTAGGG + Intronic
1112283408 13:98082690-98082712 TCCGGTACGTGAATCTGGGAGGG - Intergenic
1114069041 14:19093978-19094000 TGCAGGCCTTGTACATGGGATGG - Intergenic
1114093219 14:19306027-19306049 TGCAGGCCTTGTACATGGGATGG + Intergenic
1114988225 14:28255923-28255945 TACAATTCATGAACATGGGATGG - Intergenic
1117321977 14:54633300-54633322 TCCAGTCCTTGAACACAGCAGGG - Intronic
1119787999 14:77327131-77327153 TCCAGTGCCTGACCCTGGGAGGG + Intronic
1121945467 14:98117049-98117071 CCCAGTCCTTGAACAAGGCATGG - Intergenic
1124844470 15:33277016-33277038 TTCTGTCCATGAATATGGGATGG + Intergenic
1126567911 15:50119192-50119214 TCCATTCCGTGACCATGCCAAGG + Exonic
1126783668 15:52159471-52159493 TCCTCTCCCTGGACATGGGAAGG - Intronic
1128233521 15:66051646-66051668 TCCAGCCCCTGCAGATGGGATGG - Intronic
1129664866 15:77573849-77573871 TCCACTCCCTGAACAAGGCAAGG + Intergenic
1131886506 15:96920774-96920796 TCCAATGCATAAACATGGGATGG + Intergenic
1132225889 15:100141059-100141081 CACAGTCCGTGCACATGGCAAGG + Intronic
1132536486 16:483916-483938 TTCAGTCAGGAAACATGGGACGG - Intronic
1132998019 16:2833876-2833898 GCCAGTCAGTGATCACGGGAAGG + Intronic
1135146721 16:19969126-19969148 CCCAGTCAGTGGAGATGGGAGGG + Intergenic
1137708570 16:50551106-50551128 TCCAGTCTGGGAGGATGGGAGGG + Intronic
1138433723 16:56985618-56985640 TCCAGTCTGGGAATATGTGAGGG + Intergenic
1141270140 16:82532121-82532143 TCTAGTCTGTGAACTGGGGATGG - Intergenic
1143851167 17:9813103-9813125 TCCAGTCACAGCACATGGGAAGG + Intronic
1144645175 17:16968244-16968266 TTCAATCCATGAGCATGGGATGG - Intronic
1152190491 17:78884771-78884793 TCCAGTTCGTGCAAATGGCAAGG - Intronic
1156224540 18:35091083-35091105 TCCAATCCATAAACATGGCATGG - Intronic
1157572440 18:48721976-48721998 TCCATTCCTTAACCATGGGATGG + Intronic
1162017255 19:7852323-7852345 TTGTGTCCGTGAACATGGGCAGG + Intronic
1163327748 19:16616043-16616065 TCCAGTCCATGCCCATTGGATGG - Intronic
1164622652 19:29706407-29706429 TCCAGTCCCTGGTCATGGGCGGG - Intronic
1165056472 19:33179698-33179720 TCTAATCCATGAACATGGAATGG + Intronic
1167489454 19:49783140-49783162 TCCAGACCATGAACACAGGAGGG - Intronic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
926297981 2:11582211-11582233 TTCAGCCCGGGAACCTGGGAAGG + Intronic
926691860 2:15741764-15741786 TCCAATCTATGAACATGGTATGG + Intronic
931457539 2:62424032-62424054 TCCAGTGACTGATCATGGGAAGG - Intergenic
931646657 2:64428301-64428323 TCCAGTCCATGAACATGATATGG + Intergenic
935122761 2:100197026-100197048 CCCAGTCCGGAAAGATGGGAGGG - Intergenic
937184333 2:120025658-120025680 TCAAATTCATGAACATGGGATGG - Intronic
937211310 2:120273570-120273592 TTCAGTCCCTGAACAAGGAAAGG + Intronic
943964499 2:194315681-194315703 TCCAATCTATGAACCTGGGATGG + Intergenic
946159272 2:217826144-217826166 TCCAGTCCCAGATCATGGGGTGG + Intronic
1170405749 20:16034133-16034155 TCCAGTCCTTGATAATGGCATGG - Intronic
1170603206 20:17857546-17857568 TCCAGTCCTTGAATCAGGGATGG - Intergenic
1171268926 20:23798471-23798493 TCTAGTCGGTGAGAATGGGAGGG + Intergenic
1171280049 20:23888825-23888847 TCTAGTCGGTGAGAATGGGAGGG + Intergenic
1172346845 20:34208737-34208759 TCCAATCTATGAACATGAGATGG + Intronic
1173416024 20:42856664-42856686 TGCAGTTCCTGAACATGTGACGG + Intronic
1175020354 20:55840880-55840902 TCCAATCCATGAACATGAGATGG - Intergenic
1176350413 21:5789988-5790010 TCCTATCCGTGAGCATGGGATGG + Intergenic
1176357227 21:5910572-5910594 TCCTATCCGTGAGCATGGGATGG + Intergenic
1176544734 21:8188058-8188080 TCCTATCCGTGAGCATGGGATGG + Intergenic
1176563685 21:8371103-8371125 TCCTATCCGTGAGCATGGGATGG + Intergenic
1177101722 21:16906178-16906200 TCCAATCCATAAACATAGGAAGG - Intergenic
1177567847 21:22847067-22847089 TCCCCTCCATGAACCTGGGAGGG - Intergenic
1178388030 21:32171866-32171888 TCTGATCCATGAACATGGGATGG - Intergenic
1180487514 22:15816538-15816560 TGCAGGCCTTGTACATGGGATGG - Intergenic
1182419410 22:30241739-30241761 TCCAGTCTGAGAGCAGGGGAGGG - Exonic
1182475389 22:30574180-30574202 CCCAGTCCCTGAAGGTGGGATGG - Intronic
1182891777 22:33825269-33825291 TCCAGTCCCCAAATATGGGATGG + Intronic
1183271972 22:36867947-36867969 TCCCTTACGTGAACATGGGCTGG + Intronic
1183928265 22:41221203-41221225 TCCAGTCGGTGAACTTGGCATGG - Exonic
1185400250 22:50611808-50611830 CCCAGTCCGTGCACGTGGAAAGG - Intronic
1203249604 22_KI270733v1_random:104295-104317 TCCTATCCGTGAGCATGGGATGG + Intergenic
950175423 3:10870118-10870140 TCCTGTCTGTGAACATGGGCTGG - Intronic
954101781 3:48379093-48379115 TCCAGTCCATGAACTTGGTTGGG + Intronic
955031023 3:55218383-55218405 TCCAATCCATGACCATAGGATGG + Intergenic
955362595 3:58288444-58288466 TTCAGTCCATCAAAATGGGAGGG + Intronic
957395460 3:79630995-79631017 TCCAATCAGTAAACATGGGATGG - Intronic
958003331 3:87779544-87779566 TCCAATCCTTGAACATGGAATGG - Intergenic
959494573 3:107035319-107035341 TCCAGTCAGTGAACAGGAGCAGG + Intergenic
963225000 3:142853376-142853398 TCAGGTCTGTGAGCATGGGATGG + Intronic
964877259 3:161381858-161381880 TCTGATCCATGAACATGGGAGGG + Intergenic
965806414 3:172546817-172546839 TCTAGTCCCTGACCATGAGAAGG + Intergenic
966583830 3:181599171-181599193 TCCTATCCGTGAGCATGGAATGG + Intergenic
968782485 4:2593595-2593617 ACCAGTCCCTGAGCATGTGATGG + Intronic
973006669 4:45016276-45016298 TCCAATCCATGAGCATGGAATGG + Intergenic
974490166 4:62554491-62554513 TTCAGTACATGAGCATGGGATGG + Intergenic
974918935 4:68212787-68212809 TCTAATCCTTGACCATGGGAGGG - Intergenic
979302668 4:119105021-119105043 TCGAGGCTGTGAACATGGTAAGG + Intergenic
980496693 4:133594047-133594069 TCCAGCCCTAGAACCTGGGAGGG + Intergenic
981556195 4:145997662-145997684 TCCAATCCATGAACATGAGATGG + Intergenic
989454202 5:41623185-41623207 CCCAGTCAGTGAATATGTGATGG - Intergenic
990447261 5:55904443-55904465 TCCAGGCGGTGAGCAGGGGAAGG + Intronic
990841902 5:60091054-60091076 TCCAATTCATGAGCATGGGATGG - Intronic
991293873 5:65060841-65060863 TCCACTGGGTGCACATGGGATGG + Intergenic
992087867 5:73294300-73294322 TCCAGTATGTGAACATGAGGAGG - Intergenic
995337625 5:111018907-111018929 TCAAGTCAGTGAACATATGATGG + Intergenic
1002608302 5:180396790-180396812 TCCCCTCCTTGGACATGGGATGG - Intergenic
1003625236 6:7735262-7735284 TCCTGTACGTGAACATGGGCTGG + Intronic
1008608407 6:53163421-53163443 TCCAATCCATGAACATGGAATGG - Intergenic
1009382437 6:63049180-63049202 TCCAATCTGTGCACATGGGATGG + Intergenic
1010674991 6:78732697-78732719 TCCTATCCGTGATCATGGAAAGG - Intergenic
1010903927 6:81462278-81462300 ACCCATCCATGAACATGGGATGG + Intergenic
1012352754 6:98273248-98273270 TCCAAACTGTGAACATGGGATGG + Intergenic
1013347208 6:109272635-109272657 TCCAATTCTTGAGCATGGGATGG + Intergenic
1014297267 6:119635064-119635086 TCCAATCCATGAATATGGTAAGG - Intergenic
1021051882 7:15995396-15995418 TCCCATCCATGAACATGGAATGG + Intergenic
1021557595 7:21937164-21937186 TCCAATCCATGAACATGGGATGG - Intronic
1024042943 7:45568996-45569018 TCCAGTCCTAGAACGTGGGAGGG - Intergenic
1024197833 7:47076960-47076982 TCCAATCCATGAACATGGTATGG - Intergenic
1028455043 7:91029438-91029460 TTCAGTCCATGAGCATGGAATGG + Intronic
1030089528 7:105845415-105845437 TCCAACGCATGAACATGGGAAGG - Intronic
1037154254 8:15680204-15680226 TCCAATCCATGAGCATGGGTTGG + Intronic
1037719466 8:21430550-21430572 TCCAGTCCTTGAATAAGGTATGG - Intergenic
1038562585 8:28593385-28593407 TCCAATCCATGAGCATGGAATGG + Intergenic
1043231584 8:77808845-77808867 TCCAATCCATGAGCATGGAATGG - Intergenic
1044644650 8:94425930-94425952 TCCAGTCACTGAACATGCAAAGG + Intronic
1045471796 8:102519174-102519196 TACAGTCCTTGAATATGTGAGGG + Intergenic
1047409088 8:124609563-124609585 TCCAGTCCTTGCAAATAGGATGG + Intronic
1049565641 8:143337096-143337118 TCCAGTCCGTGAACATGGGATGG - Intronic
1052406921 9:28072948-28072970 ACCAGTCCATGAACACTGGAGGG - Intronic
1054711644 9:68516647-68516669 GGCAGTCCCTCAACATGGGAGGG + Intronic
1056260120 9:84840490-84840512 TCCAGCCAGTGCACATGGGGAGG - Intronic
1057209747 9:93193244-93193266 CCCAGTGCGTGGCCATGGGAGGG + Intronic
1057409731 9:94807514-94807536 TCCAGTCCTTGAGCCTGAGACGG + Intronic
1061899046 9:133663695-133663717 TCCAGTCAGTGACCACAGGATGG + Exonic
1062365471 9:136206237-136206259 TCCAGTACGTGAACAAAAGAGGG + Intergenic
1203465998 Un_GL000220v1:87556-87578 TCCTATCCGTGAGCATGGGATGG + Intergenic
1188869395 X:35355558-35355580 TCCTGTCCATGAGCATGGAATGG - Intergenic
1192943586 X:75939715-75939737 TCCAATTCATGAGCATGGGACGG + Intergenic
1194458927 X:94141582-94141604 TAAAGTCCATGAGCATGGGATGG - Intergenic
1199080204 X:143568323-143568345 TCCAATACGTAAACATGTGAGGG - Intergenic
1199271646 X:145890263-145890285 TCCAGTCCATGAGCATAGTATGG + Intergenic
1201448204 Y:14081336-14081358 GCCAGTTCGTGAACATTGAAAGG - Intergenic