ID: 1049566590

View in Genome Browser
Species Human (GRCh38)
Location 8:143343433-143343455
Sequence GCTGCTGGTGACCCACGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049566584_1049566590 27 Left 1049566584 8:143343383-143343405 CCAAGCTCTTCATGACCCTTTTC 0: 1
1: 0
2: 1
3: 18
4: 202
Right 1049566590 8:143343433-143343455 GCTGCTGGTGACCCACGTGCTGG 0: 1
1: 0
2: 1
3: 22
4: 215
1049566586_1049566590 11 Left 1049566586 8:143343399-143343421 CCTTTTCTCATTTTTCAAAAGTA 0: 1
1: 0
2: 8
3: 110
4: 1086
Right 1049566590 8:143343433-143343455 GCTGCTGGTGACCCACGTGCTGG 0: 1
1: 0
2: 1
3: 22
4: 215
1049566585_1049566590 12 Left 1049566585 8:143343398-143343420 CCCTTTTCTCATTTTTCAAAAGT 0: 1
1: 1
2: 8
3: 182
4: 1484
Right 1049566590 8:143343433-143343455 GCTGCTGGTGACCCACGTGCTGG 0: 1
1: 0
2: 1
3: 22
4: 215
1049566583_1049566590 28 Left 1049566583 8:143343382-143343404 CCCAAGCTCTTCATGACCCTTTT 0: 1
1: 1
2: 1
3: 12
4: 191
Right 1049566590 8:143343433-143343455 GCTGCTGGTGACCCACGTGCTGG 0: 1
1: 0
2: 1
3: 22
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049566590 Original CRISPR GCTGCTGGTGACCCACGTGC TGG Intronic
900704494 1:4071856-4071878 GCTGCTGCTGAGCCACTTCCAGG + Intergenic
900965213 1:5952714-5952736 GCTGCTGGAGCTCCACGTCCAGG - Exonic
902080496 1:13817468-13817490 TCTGCTGGTGACCCACGAGCAGG + Intronic
902334015 1:15744558-15744580 GCTGCTGGTCATCTACATGCAGG + Exonic
902633794 1:17721730-17721752 GCTGCTGGTGACTCTCTTGGAGG - Intergenic
902649303 1:17826285-17826307 CCTGCTGGTCTCCCACGTGATGG + Exonic
902786629 1:18736892-18736914 GCTGCTGGTGGCCACTGTGCTGG + Intronic
903329321 1:22589079-22589101 CCTGCTGGTGGCCAACCTGCTGG + Exonic
904409970 1:30319447-30319469 GATGCTGGTGGCTCTCGTGCAGG - Intergenic
904416206 1:30362473-30362495 GCTGCTGTTGACCATCGAGCAGG - Intergenic
906608661 1:47187750-47187772 GCTGCATGTGACCCACCTGCGGG - Intronic
907439901 1:54472719-54472741 GCTGCTGGGGAGCCATGGGCTGG + Intergenic
911491595 1:98575785-98575807 GCTGCTGGTGTCCCTTCTGCTGG + Intergenic
913327739 1:117641720-117641742 GCTGCTGTTGCTCCACTTGCAGG + Intergenic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
920779212 1:208971689-208971711 GCTGCTGTTGCCCCACTTACAGG + Intergenic
1064552946 10:16521035-16521057 GCTGCTGGTGATCCTCATCCCGG - Exonic
1065917721 10:30366666-30366688 GCTGCAGGTGACCCAGGGACTGG + Intronic
1067567366 10:47348931-47348953 GTTCCTGGTGGCCCACGTGTGGG + Exonic
1067706278 10:48608557-48608579 GGTGCTGGTGACCCCTGGGCAGG - Intronic
1075588979 10:123677822-123677844 GTTGCTGGTGGCCCCCGTGCTGG - Intronic
1076458704 10:130623463-130623485 GCTGCAGGAGACCCAGCTGCTGG + Intergenic
1076922554 10:133462136-133462158 GCTCCTGCTGTCCCACGTGTGGG + Intergenic
1077601155 11:3575862-3575884 GATGCTGGTGACTCACATGACGG - Intergenic
1077614750 11:3666738-3666760 GCTTCCGATGACCCACGTGTAGG - Intronic
1078004941 11:7525592-7525614 GTGGCTGGTCACCCACGTACAGG + Intronic
1083332402 11:61904994-61905016 GCTGCTGGGGATCGACCTGCTGG - Intronic
1083800139 11:65041748-65041770 GCTGCTGCAGGCCCAGGTGCAGG + Exonic
1084225407 11:67711971-67711993 GCTGCTGGTGACGCTGGTGGCGG - Intergenic
1084257074 11:67950437-67950459 GATGCTGGTGACTCACATGACGG - Intergenic
1084263225 11:67991821-67991843 GCTGCTGGTGACGCTGGTGGCGG - Exonic
1084810177 11:71607306-71607328 GCTGCTGGTGACGCTGGTGGCGG + Intergenic
1084815704 11:71644831-71644853 GATGCTGGTGACTCACATGACGG + Intergenic
1092427307 12:8385221-8385243 GATGCTGGTGACTCACATGACGG - Intergenic
1092936250 12:13366961-13366983 GCTGCTGCTGGCCCACCTGTGGG - Intergenic
1096121110 12:49090029-49090051 GCTGCTGGTGAACGATGTCCTGG - Exonic
1096895879 12:54820237-54820259 GCTGCTGCTGGCCCACGTGTGGG - Intergenic
1097017517 12:55997830-55997852 GATGCTGGAGACCAATGTGCTGG - Intronic
1100613556 12:96212782-96212804 GCTACCGGTGAGCCACGTGGCGG + Intronic
1100980559 12:100159134-100159156 GCTGCAGATGACCCAGGTACTGG + Intergenic
1103459308 12:121090999-121091021 GCTGCTGGTGTCCCTGGTCCAGG + Intergenic
1105927328 13:25019237-25019259 GCTGCTGGTGCCTGACGTGCAGG + Intergenic
1106451796 13:29888935-29888957 GCTGCTGGTGACCCTGGCCCTGG + Intergenic
1107069742 13:36256924-36256946 GCTGCTGCTGGCCCACCTGTGGG - Intronic
1110573108 13:77027131-77027153 GCTGTTTGTGGCCCAGGTGCAGG - Exonic
1114490081 14:23095043-23095065 GCTGCGGGTGACCGACCTGAAGG - Exonic
1114670469 14:24408231-24408253 GCTGCTGCTGAGCCTGGTGCGGG + Exonic
1121738555 14:96235709-96235731 GCTTCTGGAAACCCAGGTGCCGG + Intronic
1122769183 14:104090277-104090299 GCTGCTGCTGACTCATGTGGGGG - Intronic
1122781713 14:104146561-104146583 CCTGCTGCTGCCCCACGTGGTGG + Intronic
1123468566 15:20533808-20533830 GCTGCAGGTGACCCAGGTAATGG + Intronic
1123473329 15:20570498-20570520 GCTGCAGGTGACCCAGGTAATGG - Intergenic
1123644679 15:22429855-22429877 GCTGCAGGTGACCCAGGTAATGG + Intergenic
1123649548 15:22467254-22467276 GCTGCAGGTGACCCAGGTAATGG - Intronic
1123665996 15:22609763-22609785 GCTGCAGGTGACCCAGGTAATGG + Intergenic
1123728884 15:23129019-23129041 GCTGCAGGTGACCCAGGTAATGG + Intronic
1123733629 15:23165509-23165531 GCTGCAGGTGACCCAGGTAATGG - Intergenic
1123747048 15:23326484-23326506 GCTGCAGGTGACCCAGGTAATGG + Intergenic
1123751757 15:23362884-23362906 GCTGCAGGTGACCCAGGTAATGG - Intronic
1124279317 15:28349800-28349822 GCTGCAGGTGACCCAGGTAATGG + Intergenic
1124284129 15:28386808-28386830 GCTGCAGGTGACCCAGGTAATGG - Intronic
1124298568 15:28524806-28524828 GCTGCAGGTGACCCAGGTAATGG + Intronic
1124303381 15:28561808-28561830 GCTGCAGGTGACCCAGGTAATGG - Intergenic
1124319819 15:28704176-28704198 GCTGCAGGTGACCCAGGTAATGG + Intronic
1124437913 15:29666274-29666296 GCTGCTGGTGACACCCCTGCTGG - Intergenic
1124482692 15:30091254-30091276 GCTGCAGGTGACCCAGGTAATGG - Intronic
1124489149 15:30143346-30143368 GCTGCAGGTGACCCAGGTAATGG - Intronic
1124520885 15:30405964-30405986 GCTGCAGGTGACCCAGGTAATGG + Intronic
1124537776 15:30560255-30560277 GCTGCAGGTGACCCAGGTAATGG - Intronic
1124544232 15:30612316-30612338 GCTGCAGGTGACCCAGGTAATGG - Intronic
1124564195 15:30799752-30799774 GCTGCAGGTGACCCAGGTAATGG - Intergenic
1124754380 15:32394978-32395000 GCTGCAGGTGACCCAGGTAATGG + Intronic
1124760879 15:32447331-32447353 GCTGCAGGTGACCCAGGTAATGG + Intronic
1124777755 15:32601732-32601754 GCTGCAGGTGACCCAGGTAATGG - Intronic
1125435961 15:39645673-39645695 GCTGCTGCCCTCCCACGTGCAGG + Intronic
1129364553 15:75046361-75046383 GCTGCTGCTGACCCGCCAGCAGG - Intronic
1130484945 15:84393685-84393707 GCTGCAGGTGACACAGGTACTGG - Intergenic
1131188262 15:90293548-90293570 GCTTCAGGTGACCCAGGTACTGG - Intronic
1131282563 15:91033247-91033269 GCTGCAGGTGACCCAGGTACTGG + Intergenic
1132612062 16:822121-822143 GCTGCCGGGGACCCTCCTGCAGG - Intergenic
1132871591 16:2117938-2117960 CCTGCTGGGGACAGACGTGCAGG - Exonic
1133529875 16:6645326-6645348 GCTGCTGTTGAACCCCGTGCTGG + Intronic
1133787439 16:8984383-8984405 GCTTCAGGTGTCCCACTTGCAGG + Intergenic
1134247633 16:12551837-12551859 GCTGCTGGGGACACAGGAGCAGG + Intronic
1134520939 16:14918957-14918979 CCTGCTGGGGACAGACGTGCAGG + Intronic
1134550633 16:15137016-15137038 CCTGCTGGGGACAGACGTGCAGG - Intronic
1134708614 16:16317608-16317630 CCTGCTGGGGACAGACGTGCAGG + Intergenic
1134715828 16:16357641-16357663 CCTGCTGGGGACAGACGTGCAGG + Intergenic
1134950990 16:18351037-18351059 CCTGCTGGGGACAGACGTGCAGG - Intergenic
1134958929 16:18394518-18394540 CCTGCTGGGGACAGACGTGCAGG - Intergenic
1136025108 16:27463958-27463980 GCTGCTGATGACAGACGTGCAGG + Intronic
1136996793 16:35196092-35196114 GCTGCTGGTGCCGCTCGGGCAGG - Intergenic
1137009554 16:35309370-35309392 GCTGCTGGTGCCACGCGGGCAGG - Intergenic
1137587156 16:49670468-49670490 GCTGCTGGTGACCCATGAAGTGG - Intronic
1139371040 16:66469666-66469688 TCTGCTCGTGTCCCCCGTGCTGG + Exonic
1140477764 16:75247476-75247498 GCTGCGGGTGACACACGTCAGGG + Intronic
1143190132 17:5034561-5034583 TCTGGTGCTGACCCACCTGCTGG - Exonic
1143205821 17:5138844-5138866 GCAGAGGGTGACCCACGTCCGGG + Intronic
1143372216 17:6447498-6447520 GCTGGTGGAGACCCAGGTGAAGG + Exonic
1144497422 17:15757330-15757352 GCTGCAGGGGACCCTCATGCTGG + Intergenic
1144652212 17:17014299-17014321 GCTGCAGGGGACCCTCATGCTGG - Intergenic
1144684258 17:17215816-17215838 GCTGCTGGTCACCGCTGTGCTGG + Intronic
1145003234 17:19320244-19320266 GCTGCCTGTGACCCGCATGCTGG + Intronic
1145761701 17:27429326-27429348 GCAGAGGGTGACCCACGTCCAGG + Intergenic
1146415017 17:32623781-32623803 GGTGCTGGTGGCCCTCGTCCAGG + Intronic
1146842792 17:36166951-36166973 GCAGAGGGTGACCCACGTCCGGG - Intronic
1146855105 17:36254910-36254932 GCAGAGGGTGACCCACGTCCGGG - Intronic
1146865515 17:36333465-36333487 GCAGAGGGTGACCCACGTCCGGG + Intronic
1146871005 17:36378803-36378825 GCAGAGGGTGACCCACGTCCGGG - Intronic
1146878363 17:36429885-36429907 GCAGAGGGTGACCCACGTCCGGG - Intronic
1146882312 17:36451031-36451053 GCAGAGGGTGACCCACGTCCGGG - Intergenic
1147068384 17:37934077-37934099 GCAGAGGGTGACCCACGTCCGGG + Intronic
1147073889 17:37979427-37979449 GCAGAGGGTGACCCACGTCCGGG - Intronic
1147079907 17:38013614-38013636 GCAGAGGGTGACCCACGTCCGGG + Intronic
1147085410 17:38058965-38058987 GCAGAGGGTGACCCACGTCCGGG - Intronic
1147095856 17:38137574-38137596 GCAGAGGGTGACCCACGTCCGGG + Intergenic
1147101357 17:38182931-38182953 GCAGAGGGTGACCCACGTCCGGG - Intergenic
1147490664 17:40863196-40863218 GCCGCTGGTGGTCCACGTTCTGG + Exonic
1148465267 17:47861182-47861204 GCTGCCGGTGGCTCAGGTGCTGG + Intergenic
1148760728 17:49998458-49998480 CCTGCAGGTGACCCACTTCCGGG - Intergenic
1149845954 17:60009437-60009459 GCAGAGGGTGACCCACGTCCGGG - Intergenic
1150084303 17:62266017-62266039 GCAGAGGGTGACCCACGTCCGGG - Intergenic
1151730322 17:75907205-75907227 GCTGCTGGCCACCCAGGTGGCGG + Intronic
1155259005 18:24023365-24023387 GCCGCTGCTGAGCCACATGCAGG + Intronic
1156473541 18:37392019-37392041 GGTTCTGGTGACCCAGTTGCAGG - Intronic
1161045571 19:2132629-2132651 GCTCCTGGTGACCCAGGCGTCGG - Intronic
1161063185 19:2225513-2225535 AGTGCTGCTGACCCACCTGCTGG + Intronic
1161315550 19:3615670-3615692 GCTGCTGGTGACACACTGGGCGG + Intronic
1161948785 19:7455576-7455598 GGTCCTGGTGACCCAGGAGCAGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162968817 19:14168072-14168094 GCTGGGGGTGACCCCAGTGCTGG - Intronic
1163347156 19:16750370-16750392 GCTCCTCGTGGCCCACGTGCTGG + Exonic
1165545129 19:36528761-36528783 GCTGCACGCGACCCAGGTGCTGG + Intergenic
1166092503 19:40519458-40519480 GCTGGTGGAGAACCACGTGCTGG + Exonic
1167145998 19:47681072-47681094 GCTGCTGGAGGCCCAGGGGCAGG - Exonic
1167203857 19:48086659-48086681 GCAGCTGGTGCTCCACCTGCTGG + Intronic
1167211114 19:48134750-48134772 GCTGATAGAGCCCCACGTGCAGG + Intronic
1168324315 19:55530308-55530330 GCTGCGGGAGGCCCACCTGCGGG + Exonic
927672649 2:25082063-25082085 GCTGCTGGTGGCCCAGGTGAGGG + Intronic
928402616 2:30990260-30990282 GCTGCTGGTGACCTGTGTTCTGG - Intronic
934113578 2:88764643-88764665 GCTGCTGGTGCCTGACGTGCAGG - Intergenic
934966792 2:98730911-98730933 GCTGCGGGAGATCCACCTGCTGG - Intronic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
944711190 2:202336378-202336400 GCTGGTGGAGACCCAGGTGAAGG - Intergenic
946337607 2:219049008-219049030 GCTGCTGGAGACCCGGGTTCTGG + Intergenic
948166211 2:235864562-235864584 GCTGCTGGTGACACCTCTGCAGG - Intronic
948381098 2:237550472-237550494 GCTCCTGGAGAGCCATGTGCTGG + Intronic
948781590 2:240324862-240324884 GGTGCTGCTGTCCCATGTGCCGG - Intergenic
949036142 2:241816551-241816573 GCTGCTGTAGACCCCCGTGGAGG + Exonic
1176958999 21:15138716-15138738 GCTGCTGGAGACCCAGCTGCGGG + Intergenic
1179435673 21:41360570-41360592 GCTGCTGGTGAGGGGCGTGCAGG + Intergenic
1179645063 21:42770569-42770591 GCTCCTGGACACCCTCGTGCCGG - Intronic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1182143693 22:27983744-27983766 GTTGCTGGTAACCCAAGGGCAGG + Exonic
1182704849 22:32270669-32270691 GCTGCTGGGCATCCACCTGCTGG + Intergenic
1183598834 22:38828395-38828417 GCAGCTGCTGGCCCAGGTGCTGG - Exonic
1184693514 22:46127963-46127985 GCAGCTGGTGACACAGGTGGGGG - Intergenic
1185151540 22:49166838-49166860 GCTGCTGGTGACCCTCAGGATGG + Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950750488 3:15124284-15124306 GATGCTGGTGACTCACATGACGG + Intergenic
952787971 3:37175498-37175520 GCTGCTGGTTACTCACAGGCAGG + Intronic
953103806 3:39855801-39855823 GCTGCTGCAGACACAAGTGCAGG - Intronic
953348292 3:42194679-42194701 GCAGCTGGTTCCACACGTGCTGG + Intronic
954405942 3:50345123-50345145 GCTGCTGGTCACCCATGGGAAGG - Exonic
957048961 3:75396897-75396919 GCTGCTGGTGCCTGATGTGCAGG + Intergenic
957078665 3:75619763-75619785 GCTGCTGGTGACGCTGGTGGCGG - Intergenic
961282126 3:125772171-125772193 GATGCTGGTGACTCACATGACGG + Intergenic
967224117 3:187274913-187274935 ACTGCTGGTTTCCCACCTGCGGG - Intronic
968589142 4:1449076-1449098 GCTCCTGGGGACCCGCGTTCTGG - Intergenic
968657238 4:1783899-1783921 GCTGCAGGTGACCCCCATCCTGG - Intergenic
969021746 4:4143731-4143753 GCTGCTGGTGACGCTGGTGGCGG - Intergenic
969676557 4:8617644-8617666 GTTGCTGCTGAGCCCCGTGCAGG + Intronic
969797546 4:9537667-9537689 GATGCTGGTGACTCACGTGACGG + Intergenic
972475635 4:39446868-39446890 CCTGCTGGTGGCCCACGCCCTGG + Exonic
976187597 4:82458080-82458102 GCTGCCGATGACCCAAGTTCTGG - Intronic
978159316 4:105527046-105527068 GCTGGTGGAGACCCAGGTGAAGG - Intergenic
984474288 4:180216576-180216598 GCTGCTGCTGGCCCACATGTGGG - Intergenic
985146200 4:186896433-186896455 CCTGCTGGAGCCCCGCGTGCTGG - Intergenic
985885646 5:2675731-2675753 GCTTTTGGTGACCTACTTGCAGG - Intergenic
986745126 5:10736987-10737009 GCAGCAGCTGACCCAGGTGCTGG - Intronic
988264296 5:28928784-28928806 GCTGCTGGTGCCTGACGTGCAGG + Intergenic
989195312 5:38710640-38710662 GCAGCTGGAGACCTAGGTGCCGG + Intergenic
989631086 5:43483619-43483641 GGTGCGTGTGACCCACGAGCCGG - Intronic
994364679 5:98899648-98899670 GCAGATGGTGACCCAAATGCAGG - Exonic
995650388 5:114362289-114362311 GCTGCTGGTGCGCGAGGTGCGGG - Exonic
1000776165 5:165422865-165422887 GATGCTGGTGGTCCATGTGCTGG + Intergenic
1003382211 6:5635574-5635596 GATGCAGGTGACACATGTGCTGG + Intronic
1005992764 6:30913851-30913873 GCTGCTGCTGGCCCACGCGCGGG + Exonic
1007252918 6:40508507-40508529 ACTGCTGGAGACCTAGGTGCAGG - Intronic
1009398196 6:63227444-63227466 GGTGCTTGTGACCCACCTTCCGG + Intergenic
1010339588 6:74732601-74732623 GCTGGTGGTGGCCCACTTCCTGG - Intergenic
1012245898 6:96925084-96925106 GCTGCTGGTGCGCCAAGTGGGGG + Intronic
1018911279 6:168101863-168101885 GCTGCTGGCGACCCCGCTGCCGG + Intergenic
1020151470 7:5685037-5685059 GCTGATGGTGAGCCACGCTCTGG + Intronic
1020309163 7:6855761-6855783 GCTGCTGGTGACGCTGGTGGTGG - Intergenic
1022877814 7:34552967-34552989 CATGCTGGTGACCCTGGTGCAGG - Intergenic
1023761551 7:43469105-43469127 GGTGAGTGTGACCCACGTGCGGG + Exonic
1024772748 7:52743718-52743740 GCTCCTGCTGACCCATGTGAGGG - Intergenic
1027971429 7:85087416-85087438 GTTGCTGTCTACCCACGTGCAGG + Intronic
1029074272 7:97923871-97923893 GATGCTGGTGACTCACATGACGG - Intergenic
1032257850 7:130311382-130311404 GCTCCTGATGGCCCACGTTCTGG - Intronic
1032731421 7:134646916-134646938 GCTGCTGGTGGCCCCTTTGCAGG + Exonic
1035043881 7:155951605-155951627 GCTGCTGGTGACTCAAGGCCGGG + Intergenic
1035566293 8:643490-643512 ACTGATGGTCACCCCCGTGCAGG + Intronic
1036243435 8:7097417-7097439 GATGCTGGTGACTCACATGACGG + Intergenic
1036257378 8:7216650-7216672 GATGCTGGTGACTCACGTGACGG - Intergenic
1036309425 8:7675246-7675268 GATGCTGGTGACTCACGTGACGG - Intergenic
1036360114 8:8070873-8070895 GATGCTGGTGACTCACGTGACGG + Intergenic
1036453944 8:8892482-8892504 GCTGGTTGTGATCCACGTCCAGG + Exonic
1036829290 8:12009774-12009796 GATGCTGGTGACTCACATGACGG - Intergenic
1036890851 8:12596095-12596117 GATGCTGGTGACTCACGTGACGG - Intergenic
1036898396 8:12654012-12654034 GATGCTGGTGACTCACGTGACGG - Intergenic
1037653981 8:20867241-20867263 GCTGCTGCAGACCAACGGGCTGG + Intergenic
1039605157 8:38874495-38874517 GCTGCTTGTGACGCAGGCGCAGG + Intergenic
1040060308 8:43097958-43097980 GCTGCTAGTGTCCCAGGTGTGGG + Intronic
1044854127 8:96457340-96457362 GCTGCGGGTGTCCCACTTGATGG - Intergenic
1047807236 8:128373210-128373232 GCTGCTGGAGATGCAGGTGCTGG + Intergenic
1047807283 8:128373627-128373649 GCTGCTAGTGATGCAGGTGCTGG + Intergenic
1049282955 8:141759796-141759818 GCTGCTGGAGGCCCACGTGTGGG - Intergenic
1049566590 8:143343433-143343455 GCTGCTGGTGACCCACGTGCTGG + Intronic
1049738738 8:144224026-144224048 GCTGGTGGCGGCCCACCTGCTGG - Intronic
1051902181 9:22055681-22055703 GGTGCAGATGATCCACGTGCTGG + Intergenic
1052969884 9:34370945-34370967 GCTGCTTGTGGCCCCGGTGCTGG - Exonic
1053374538 9:37594015-37594037 TCTGCTGGTGATGCACGGGCAGG + Intronic
1053715727 9:40885335-40885357 GCTGCTGGTGCCTGATGTGCGGG + Intergenic
1054076822 9:60545403-60545425 GCTGCTGGTGCCTGATGTGCAGG - Intergenic
1054748539 9:68880831-68880853 GCTGCAGGTGTCCCCAGTGCAGG - Intronic
1055532038 9:77194195-77194217 GCTGGTGGAGGCCCATGTGCAGG + Intronic
1056558115 9:87706626-87706648 GCTGCTGGTCAACCACGGCCAGG + Exonic
1057133360 9:92669907-92669929 CCTGGTGGTGGCCCACGCGCAGG - Exonic
1060069509 9:120533953-120533975 GCTGATGGTGACCAAAGTGGAGG - Intronic
1061062859 9:128259322-128259344 GCTGCAGGTGTCCCAGGTACTGG + Exonic
1062462483 9:136667718-136667740 GCAGCTGCTGGCCCACCTGCTGG + Intronic
1186006482 X:5077963-5077985 GCTGATGGGGACCCACTTCCTGG + Intergenic
1192510367 X:71717581-71717603 GCTGCTGGGGATCCACGCGGAGG + Exonic
1192516330 X:71763972-71763994 GCTGCTGGGGATCCACGCGGAGG - Exonic
1202373162 Y:24211600-24211622 GCTGCAGGTGACACAGGTACTGG + Intergenic
1202497620 Y:25458520-25458542 GCTGCAGGTGACACAGGTACTGG - Intergenic