ID: 1049568395

View in Genome Browser
Species Human (GRCh38)
Location 8:143355681-143355703
Sequence TCGGGGGCCCAGATGTAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 44}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049568395_1049568403 20 Left 1049568395 8:143355681-143355703 CCTTGTTACATCTGGGCCCCCGA 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1049568403 8:143355724-143355746 ACCTCTGCACCTGTCAGAGGCGG No data
1049568395_1049568400 -3 Left 1049568395 8:143355681-143355703 CCTTGTTACATCTGGGCCCCCGA 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1049568400 8:143355701-143355723 CGACACGAATGTGCAAGAGCCGG No data
1049568395_1049568402 17 Left 1049568395 8:143355681-143355703 CCTTGTTACATCTGGGCCCCCGA 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1049568402 8:143355721-143355743 CGGACCTCTGCACCTGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049568395 Original CRISPR TCGGGGGCCCAGATGTAACA AGG (reversed) Intronic
900347229 1:2215545-2215567 TCGGGGGCCCAGTGGTCCCAAGG - Intergenic
914338231 1:146736469-146736491 CCTGGGGGCCAGATGTAACTGGG - Intergenic
1081333064 11:41827821-41827843 AAGTGGGCCCACATGTAACATGG + Intergenic
1082745462 11:56956399-56956421 CCAGGGGCTCAGATGTAACTGGG - Intergenic
1090183139 11:124718315-124718337 TCTGGGACCCAGATGAAGCAGGG + Intergenic
1099072336 12:78060945-78060967 TCTGGGGCCCTGATGGAGCAAGG - Intronic
1106785067 13:33099331-33099353 TGGGGTGCCCAGATTAAACATGG - Intergenic
1119473296 14:74912353-74912375 TCTGGGGTCCAGGTGGAACAGGG - Intronic
1119473304 14:74912390-74912412 TCTGGGGTCCAGGTGGAACAGGG - Intronic
1133921133 16:10154192-10154214 TTGTGGGCCCAGATGGAGCATGG - Intronic
1139675930 16:68523531-68523553 TCGGGGGCACAGAGGTATCTGGG + Intergenic
1139996049 16:70980872-70980894 CCTGGGGGCCAGATGTAACTGGG + Intronic
1146579629 17:34025174-34025196 TCAGGGGCTCAGAAGGAACAAGG - Intronic
1148083591 17:44980810-44980832 ACAGGGGCCCAGATGAAACCAGG + Intergenic
1150321205 17:64215970-64215992 TCAAGGGCCCAGCTGCAACATGG + Intronic
1160933144 19:1580214-1580236 GAGGGGGCCCAGAGGTACCACGG + Intronic
1166773705 19:45299834-45299856 TCGGGGGACCTGAGGTCACAAGG + Exonic
1167774359 19:51545027-51545049 CCTGGAGCCCAGATGCAACAGGG + Intergenic
929791303 2:45024998-45025020 TCAGGTGCCCAGATTTGACATGG + Intergenic
932402157 2:71488486-71488508 CAGGGGGCCCAGATGCAACAAGG + Intronic
935960753 2:108423595-108423617 TCTGGGCCACAGATGTCACATGG + Intergenic
948505718 2:238426068-238426090 TGGGTGGCCCAGATGCACCAGGG - Intergenic
1172841134 20:37903302-37903324 TCCGGGGCCCAGATGTGAGGCGG + Exonic
1176197926 20:63846223-63846245 TTAGGGGCCCAGATGGGACAGGG - Intergenic
1176244462 20:64090897-64090919 TCTGGGGCCCAGCTGTGGCAGGG + Intronic
1176244486 20:64090975-64090997 TCTGGGGCCCAGCTGTGGCAGGG + Intronic
1176244565 20:64091248-64091270 TCTGGGGCCCAGCTGTGGCAGGG + Intronic
1179922451 21:44514445-44514467 TCGGGGGCCCAGCTGTGACGAGG + Intronic
1181619820 22:24083154-24083176 TCTGGGGCCCTGCTGTGACAGGG + Intronic
1183172932 22:36201432-36201454 TCTGGGGCCCCCATGCAACAAGG + Intronic
1183671061 22:39273166-39273188 TGGGGAGCCCAGATCCAACAGGG - Intergenic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
951441054 3:22724545-22724567 TCTGGGCCCCAGATGTAAACTGG - Intergenic
962573639 3:136736017-136736039 TTGAAGGCCCAGATGAAACAGGG - Intronic
963093284 3:141507424-141507446 TTGGTGGCCTAGATGCAACATGG - Intronic
966910604 3:184557543-184557565 CTGGGGGCCCAGATATAAAAGGG + Intronic
1002055013 5:176593819-176593841 ACAGGGGCCCAGGTATAACACGG + Intronic
1003057945 6:2840436-2840458 TCTGGGGACCAGAGGTAACACGG - Exonic
1006636680 6:35466323-35466345 TCAGGGGCCCAAATGTTTCAAGG - Exonic
1011148243 6:84242309-84242331 TCTGGGGACCAGCTGTAGCAGGG + Intergenic
1021865675 7:24954599-24954621 GAGGGGGCCAAGATGTAAAAAGG + Intronic
1029215355 7:98944598-98944620 TTGGGGGCCCAGAGACAACAGGG + Intronic
1029420090 7:100467786-100467808 GCGGGGGCCCAGATGTCCCTCGG + Intronic
1031173523 7:118320589-118320611 TTGGGGGCCTAGATGGATCAGGG - Intergenic
1035171109 7:157017976-157017998 CCGGGGGCCCAGATGCACCCAGG - Intergenic
1043542794 8:81281363-81281385 TCGGGGGCCCTGGTGTTCCATGG - Intronic
1049568395 8:143355681-143355703 TCGGGGGCCCAGATGTAACAAGG - Intronic
1049694015 8:143974907-143974929 TCCAGTGCCCAGATGCAACAAGG - Intronic
1186672548 X:11781857-11781879 TCTGGGGCCCAGATGACAGAGGG + Intergenic
1190057740 X:47191444-47191466 TCGGGGGCCCAGATGTTTCTAGG + Intronic