ID: 1049570633

View in Genome Browser
Species Human (GRCh38)
Location 8:143368840-143368862
Sequence CCCGACTGTCCCTCCTGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 190}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049570633_1049570646 21 Left 1049570633 8:143368840-143368862 CCCACTCAGGAGGGACAGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 190
Right 1049570646 8:143368884-143368906 GCCCGCGGCCCAGGTGGTGCGGG 0: 1
1: 0
2: 2
3: 26
4: 280
1049570633_1049570645 20 Left 1049570633 8:143368840-143368862 CCCACTCAGGAGGGACAGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 190
Right 1049570645 8:143368883-143368905 AGCCCGCGGCCCAGGTGGTGCGG 0: 1
1: 0
2: 1
3: 30
4: 237
1049570633_1049570640 -3 Left 1049570633 8:143368840-143368862 CCCACTCAGGAGGGACAGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 190
Right 1049570640 8:143368860-143368882 GGGGACCGGCGCGGGCACTCAGG 0: 1
1: 0
2: 1
3: 13
4: 138
1049570633_1049570644 15 Left 1049570633 8:143368840-143368862 CCCACTCAGGAGGGACAGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 190
Right 1049570644 8:143368878-143368900 TCAGGAGCCCGCGGCCCAGGTGG 0: 1
1: 0
2: 1
3: 22
4: 242
1049570633_1049570643 12 Left 1049570633 8:143368840-143368862 CCCACTCAGGAGGGACAGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 190
Right 1049570643 8:143368875-143368897 CACTCAGGAGCCCGCGGCCCAGG 0: 1
1: 1
2: 2
3: 28
4: 260
1049570633_1049570642 6 Left 1049570633 8:143368840-143368862 CCCACTCAGGAGGGACAGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 190
Right 1049570642 8:143368869-143368891 CGCGGGCACTCAGGAGCCCGCGG 0: 1
1: 0
2: 1
3: 17
4: 511
1049570633_1049570649 24 Left 1049570633 8:143368840-143368862 CCCACTCAGGAGGGACAGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 190
Right 1049570649 8:143368887-143368909 CGCGGCCCAGGTGGTGCGGGCGG 0: 1
1: 0
2: 0
3: 19
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049570633 Original CRISPR CCCGACTGTCCCTCCTGAGT GGG (reversed) Intronic
900170188 1:1263878-1263900 CCCGCCTCAGCCTCCTGAGTAGG - Intronic
900785223 1:4645171-4645193 CCTGACTCAGCCTCCTGAGTAGG + Intergenic
901001725 1:6152138-6152160 CCTGGCTCACCCTCCTGAGTGGG - Intronic
901013094 1:6211904-6211926 CCCCACTGCCCCTCCCCAGTAGG + Exonic
901409740 1:9073966-9073988 CCCGCCTTAGCCTCCTGAGTAGG - Intronic
901559295 1:10057526-10057548 CCTGCCTGAGCCTCCTGAGTAGG + Intronic
901866515 1:12110162-12110184 CCCGACTCTCCCTCCTCTGTGGG + Exonic
905346275 1:37313143-37313165 CCAGACAGCCCCTCCTGGGTGGG - Intergenic
908569389 1:65392739-65392761 CCTGACTGTCCAGCCTGGGTGGG - Exonic
912791983 1:112661244-112661266 CCAGCCTGTCTCACCTGAGTTGG - Intronic
914835616 1:151204286-151204308 CCTGCCTCTGCCTCCTGAGTAGG + Intronic
915384584 1:155478450-155478472 CCCCAGTGTTCCTCCTGAGATGG - Exonic
915559336 1:156677278-156677300 CGCGTCTGTCCATCCTCAGTGGG - Exonic
916227895 1:162508221-162508243 CCCTCCTCACCCTCCTGAGTAGG + Intronic
919085835 1:192919240-192919262 CTCGACTGTCCCACATCAGTGGG - Intergenic
919791480 1:201293543-201293565 CCTGCCTGTCTCCCCTGAGTGGG + Intronic
921557437 1:216615797-216615819 CCTGACTCAGCCTCCTGAGTAGG + Intronic
921923761 1:220695105-220695127 CCAGACAGTCCCTCATGGGTTGG + Intronic
923646852 1:235831239-235831261 CCCCACAGTCCCTGCTGAGAGGG + Intronic
924031172 1:239887311-239887333 CCTGCCTCACCCTCCTGAGTAGG + Intronic
1063035152 10:2279820-2279842 GCCTAGTGTCCCTCCTGAGGGGG + Intergenic
1065024237 10:21526128-21526150 CCCGACTGCCCCGGCGGAGTCGG + Intergenic
1066682421 10:37947069-37947091 CCTGACTCAGCCTCCTGAGTAGG + Intergenic
1068126630 10:52849425-52849447 CCTGCCTCTGCCTCCTGAGTAGG + Intergenic
1071475084 10:86018985-86019007 CCTGACTGTGCCTTCTGATTTGG - Intronic
1076698613 10:132258742-132258764 TCCCACTGCCCCTCCTGAGCGGG + Intronic
1081996325 11:47366707-47366729 CCTGACTCAGCCTCCTGAGTAGG - Intronic
1085106236 11:73845656-73845678 CCCGCCTCACCCTCCCGAGTAGG - Intronic
1086496728 11:87411710-87411732 CCCTATTGTCTCTCCTGATTTGG - Intergenic
1089864010 11:121616162-121616184 CCCAACTATCTCTCCAGAGTAGG + Intronic
1089975150 11:122725640-122725662 CCCCACTTTTCCTCCTGAGTAGG - Intronic
1091225063 11:133952047-133952069 CCTGACTGTCCTTTCTGAGAAGG - Intronic
1091803817 12:3342140-3342162 GCCGACTGGCCTTCCTAAGTGGG + Intergenic
1092169905 12:6367671-6367693 CTCGACTGTCAAACCTGAGTGGG + Intronic
1094621368 12:32083459-32083481 CCTGCCTGAGCCTCCTGAGTAGG - Intergenic
1096980602 12:55726454-55726476 CCTGCCTCACCCTCCTGAGTAGG + Intronic
1098123294 12:67265370-67265392 CCCGCCTCAGCCTCCTGAGTAGG + Intergenic
1098536678 12:71601123-71601145 CCCACCTCACCCTCCTGAGTAGG + Intergenic
1103837049 12:123829944-123829966 CCCGACTGTCCCGTCTGAATGGG + Intronic
1104109204 12:125689547-125689569 CCCGCCTCAGCCTCCTGAGTTGG - Intergenic
1105556698 13:21453956-21453978 CCCGTCTCAGCCTCCTGAGTAGG + Intronic
1106183817 13:27390604-27390626 CTTGACTGTCCCTGCTCAGTGGG - Intergenic
1107803704 13:44134327-44134349 CCCGCCTCAGCCTCCTGAGTAGG + Intergenic
1115626320 14:35196380-35196402 CCCGCCTCAGCCTCCTGAGTTGG - Intronic
1117566078 14:56994870-56994892 CCTGTCTCTGCCTCCTGAGTAGG - Intergenic
1118884366 14:69854016-69854038 CCCCACTGGCCCTGCTGAGTGGG + Intergenic
1118928732 14:70219739-70219761 CCCGTCTCAGCCTCCTGAGTAGG + Intergenic
1120786402 14:88541623-88541645 CCCCTCTGTCCCCCCTGAGAGGG + Intronic
1121219717 14:92276469-92276491 GCCGACTGCCCCTCCTGTCTTGG - Intergenic
1123963612 15:25433956-25433978 CCCATCTCACCCTCCTGAGTAGG - Intronic
1125546917 15:40512664-40512686 TCAGACCTTCCCTCCTGAGTGGG + Intergenic
1126838512 15:52692769-52692791 CCTGTCTCTGCCTCCTGAGTAGG + Intronic
1129441053 15:75580920-75580942 CCCGCCTCAGCCTCCTGAGTAGG + Intergenic
1131873099 15:96780489-96780511 CCCATCTGTCTCTCCTGAGTTGG + Intergenic
1132921077 16:2393225-2393247 CCCGCCTCAGCCTCCTGAGTAGG - Intergenic
1133033471 16:3022405-3022427 CCCGACTGACTCCCCTGAGCTGG + Intergenic
1133204431 16:4224597-4224619 CCCGCCTCAGCCTCCTGAGTAGG - Intronic
1133226618 16:4343879-4343901 CCTGACTCTCCCTCATGATTTGG - Intronic
1133290652 16:4718568-4718590 CCAGCCTGTCCCTCCAGAGCTGG - Intronic
1133467124 16:6038291-6038313 CCTGCCTGAGCCTCCTGAGTAGG + Intronic
1135264652 16:21012871-21012893 CCCGCCTCAGCCTCCTGAGTAGG + Intronic
1135416812 16:22274717-22274739 CCCGCCTCAGCCTCCTGAGTAGG + Intronic
1137550928 16:49437067-49437089 CCTGGCTGTTCCTCCTGAGAAGG + Intergenic
1138219836 16:55241268-55241290 CCTGCCTCTGCCTCCTGAGTAGG + Intergenic
1138324112 16:56147391-56147413 CCCAACTCAGCCTCCTGAGTAGG - Intergenic
1138437449 16:57011608-57011630 CCTGCCTCACCCTCCTGAGTAGG - Intronic
1139686563 16:68608547-68608569 CCAGCCTGAGCCTCCTGAGTAGG - Intergenic
1139892332 16:70261484-70261506 CCTGCCTCTGCCTCCTGAGTAGG - Intronic
1141041101 16:80673206-80673228 CCTGCCTCTGCCTCCTGAGTAGG - Intronic
1142608601 17:1095952-1095974 CACGACTGGCCCTCCTGGGGTGG - Intronic
1142931713 17:3290727-3290749 CCTGAATGTCCCTTCTCAGTAGG - Intergenic
1150123193 17:62619988-62620010 CCTGCCTGTCCTTCCTGAGTTGG + Intergenic
1150779962 17:68113833-68113855 CCTGCCTCACCCTCCTGAGTAGG + Intergenic
1151236168 17:72721206-72721228 CCCGCCTCAGCCTCCTGAGTAGG + Intronic
1151477746 17:74353414-74353436 CCCCGCTGTCTCTGCTGAGTGGG + Intronic
1153868503 18:9295346-9295368 CCCGCCTCAGCCTCCTGAGTAGG - Intergenic
1156449113 18:37256694-37256716 CCTGCCTCTACCTCCTGAGTAGG + Intronic
1158573800 18:58618961-58618983 CCCTCCTGTCCCCGCTGAGTAGG - Intronic
1160795226 19:942285-942307 CCTGACTGTCGATCCTGACTGGG + Intronic
1162140984 19:8585476-8585498 CCCCACTTGCCCTCCGGAGTGGG - Exonic
1162164706 19:8744347-8744369 CCCACCTGAGCCTCCTGAGTAGG - Intergenic
1162165777 19:8751815-8751837 CCCACCTGAGCCTCCTGAGTAGG - Intergenic
1162166843 19:8759271-8759293 CCCACCTGAGCCTCCTGAGTAGG - Intergenic
1162167909 19:8766731-8766753 CCCACCTGAGCCTCCTGAGTAGG - Intergenic
1162168848 19:8773025-8773047 CCCACCTGAGCCTCCTGAGTAGG - Intergenic
1162170594 19:8785793-8785815 CCCACCTGAGCCTCCTGAGTAGG - Intergenic
1163116490 19:15191927-15191949 CCCCTCTGACTCTCCTGAGTAGG + Intronic
1165689949 19:37855525-37855547 CCATCCTGTCCCTCCTGTGTGGG - Intergenic
1165783107 19:38445142-38445164 CCTGCCTCACCCTCCTGAGTAGG - Intronic
1166015706 19:39977928-39977950 CCCACCTGTCTCTCCTAAGTAGG + Intronic
1166389425 19:42400925-42400947 CCTGCCTCACCCTCCTGAGTAGG + Intergenic
1168673177 19:58257031-58257053 CCTGCCTGAGCCTCCTGAGTAGG + Intronic
926191249 2:10729620-10729642 CTCAACTGTCCCTCCTGCCTTGG - Intronic
928115194 2:28541057-28541079 CCCGCCTCAGCCTCCTGAGTAGG - Intronic
929470971 2:42192349-42192371 CCCGCCTCAGCCTCCTGAGTAGG + Intronic
930427371 2:51228913-51228935 CCCGCCTCAGCCTCCTGAGTAGG - Intergenic
930637461 2:53821992-53822014 CCTGCCTCTGCCTCCTGAGTAGG + Intergenic
930704317 2:54489207-54489229 CCTGCCTCTACCTCCTGAGTAGG - Intronic
931953170 2:67388137-67388159 CCCGCCTTAGCCTCCTGAGTAGG + Intergenic
932051872 2:68405880-68405902 CCCCCCTGTGCCTCCTGACTGGG + Intergenic
934964435 2:98707779-98707801 CCTGCCTGTCCCTTCTGAGAAGG + Intronic
936555797 2:113497993-113498015 CCCGCCTCAGCCTCCTGAGTAGG - Intergenic
936722429 2:115269033-115269055 CCCGTCTCAGCCTCCTGAGTAGG - Intronic
941409980 2:165142860-165142882 CCTGCCTTACCCTCCTGAGTTGG + Intronic
944196743 2:197062475-197062497 ACCCACTGTCCCTTCTAAGTAGG - Intronic
945295887 2:208171255-208171277 CCCAACTCAGCCTCCTGAGTAGG + Intronic
948448120 2:238049487-238049509 CCTGCCTCACCCTCCTGAGTAGG - Intronic
948938563 2:241184476-241184498 CCCGCCTCAGCCTCCTGAGTAGG + Intergenic
1169475378 20:5926323-5926345 CCCGCCTTGGCCTCCTGAGTAGG - Intergenic
1170540720 20:17384817-17384839 CCCGTCTCAACCTCCTGAGTAGG - Intronic
1174512740 20:51067055-51067077 CCCACCTGAGCCTCCTGAGTAGG + Intergenic
1175154847 20:56963738-56963760 ACAGACTGTGACTCCTGAGTGGG + Intergenic
1178072859 21:28988353-28988375 CATGACTCACCCTCCTGAGTAGG - Intronic
1179144377 21:38754371-38754393 CCCGCCTCAGCCTCCTGAGTAGG - Intergenic
1180460295 22:15557244-15557266 CCTGCCTCACCCTCCTGAGTAGG + Intergenic
1180847029 22:18989107-18989129 CCCGCCTCAGCCTCCTGAGTAGG - Intergenic
1180855825 22:19044137-19044159 CCCAACTGTCCCTCCAAGGTGGG + Intronic
1181098549 22:20522942-20522964 CCCGTCTCTCCCTCCTGTTTTGG + Intronic
1181519495 22:23437004-23437026 CCCGAGTGTCTGTCCTGGGTGGG + Intergenic
1182106712 22:27694959-27694981 CCCGGCTGTCCCTCCTTGGCAGG + Intergenic
1183522875 22:38305995-38306017 CCCAAATGTCCCTCCTGAGGGGG + Intronic
1184123030 22:42465872-42465894 CCTGACTCAGCCTCCTGAGTAGG - Intergenic
1184509840 22:44927004-44927026 CTCGACGCTCCCTCCTGACTTGG + Intronic
1184733407 22:46383636-46383658 CCCGCCTCAGCCTCCTGAGTAGG + Intronic
1185319491 22:50193952-50193974 TCAGCCTGTCCCTCCTGAGTGGG + Intronic
949368119 3:3305259-3305281 CTCCACTGTCCCTCCCGAATCGG + Intergenic
950808040 3:15625254-15625276 CCATTCTGTCCCGCCTGAGTGGG - Intronic
952935083 3:38391100-38391122 CCCGCCTCAGCCTCCTGAGTAGG - Intronic
953385989 3:42505883-42505905 GCCAACTCTGCCTCCTGAGTGGG + Intronic
955432597 3:58864068-58864090 CCTGCCTGAGCCTCCTGAGTAGG + Intronic
968856496 4:3128042-3128064 CCCGCCTCAGCCTCCTGAGTAGG + Intronic
970090824 4:12405941-12405963 CCTGACTCAGCCTCCTGAGTAGG - Intergenic
975418512 4:74134630-74134652 AGCGACTGACCCTCCTGAGATGG + Intronic
979364679 4:119806956-119806978 CTCAAGTGTCCCTCCTGACTTGG + Intergenic
982144099 4:152363389-152363411 CCTGTCCTTCCCTCCTGAGTTGG - Intronic
982178263 4:152726986-152727008 CCTGACTCAGCCTCCTGAGTAGG + Intronic
986757375 5:10850864-10850886 CCCGACTGTTTCTTCTGGGTTGG + Intergenic
989397199 5:40970542-40970564 CCTGACTCAACCTCCTGAGTAGG - Intronic
991184108 5:63787542-63787564 CCTGACTCAGCCTCCTGAGTAGG - Intergenic
992595774 5:78345870-78345892 TCTCACTGTCCCTCCTGAGATGG + Intergenic
993312082 5:86347017-86347039 CCCGCCTCAGCCTCCTGAGTAGG - Intergenic
997370719 5:133357944-133357966 GCCGACTGGTCCTCCTGAGTGGG - Intronic
997906723 5:137824518-137824540 CCCACCTCTACCTCCTGAGTGGG + Intergenic
998024141 5:138799270-138799292 CCTGCCTCTGCCTCCTGAGTAGG + Intronic
998252399 5:140561908-140561930 CCAAACTGTCCCTGCTGAGCTGG + Intronic
999437885 5:151578220-151578242 CCAGAATGTCCCTGCTGAATGGG + Intergenic
1004274339 6:14222356-14222378 CCCCCCTGTCTCTCCTGGGTGGG + Intergenic
1005290091 6:24371163-24371185 CCCGCCTCAGCCTCCTGAGTAGG - Intergenic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1006227893 6:32555975-32555997 CCTGACTCAGCCTCCTGAGTTGG + Intronic
1006563114 6:34930986-34931008 CCCGCCTCAGCCTCCTGAGTAGG + Intronic
1006848569 6:37080743-37080765 CCCGCCTCAGCCTCCTGAGTAGG + Intergenic
1007227554 6:40325599-40325621 CCTGACTGCCCATCCTGGGTAGG + Intergenic
1008931021 6:56939912-56939934 CCTGCCTGAGCCTCCTGAGTAGG - Intronic
1009719482 6:67448638-67448660 CCGGACTTTCACTCCTTAGTTGG + Intergenic
1009983968 6:70760041-70760063 CCAGACTTTCCCTCCTGTATCGG + Intronic
1010485966 6:76415228-76415250 CCCGCCTCAGCCTCCTGAGTAGG + Intergenic
1016962917 6:149690656-149690678 CCCAACTCAGCCTCCTGAGTAGG + Intronic
1017920783 6:158870196-158870218 CGCGGCTGTGCCTCCTGAGCAGG + Intronic
1018310480 6:162503272-162503294 CCCGCCTCAGCCTCCTGAGTAGG + Intronic
1019591767 7:1839274-1839296 CCCGAGTGTCTGTCCTGGGTGGG - Intronic
1021417636 7:20406436-20406458 CCTGCCTATGCCTCCTGAGTAGG - Intronic
1021707770 7:23384777-23384799 CCCACCTCACCCTCCTGAGTAGG - Intronic
1024549583 7:50551340-50551362 CCCGCCTTGACCTCCTGAGTAGG + Intronic
1029554455 7:101258375-101258397 CCCGCCTCAGCCTCCTGAGTAGG - Intergenic
1029997319 7:105019994-105020016 CCTGCCTCGCCCTCCTGAGTAGG - Intronic
1030040020 7:105441159-105441181 CCAGACTCAGCCTCCTGAGTAGG + Intronic
1031092568 7:117377414-117377436 CCCGCCTGAGCCTCCTGAGTAGG - Intronic
1032820040 7:135516034-135516056 CCCGCCTCAGCCTCCTGAGTAGG + Intergenic
1033099199 7:138456290-138456312 CCCTCCTCTGCCTCCTGAGTAGG + Intergenic
1036172924 8:6507686-6507708 CCTGCCTGAGCCTCCTGAGTAGG + Intronic
1041863343 8:62539006-62539028 ACTGAATGACCCTCCTGAGTTGG - Intronic
1042503500 8:69535653-69535675 CCCCACTGGCTCTCCTTAGTTGG - Intronic
1043291848 8:78611985-78612007 CTCATCTGTCCCTCCAGAGTAGG + Intergenic
1045462036 8:102433729-102433751 CCTGACTCAGCCTCCTGAGTAGG - Intergenic
1046234646 8:111407049-111407071 CCCACCTCTGCCTCCTGAGTAGG - Intergenic
1049254063 8:141604681-141604703 CCCGGCTGTCCTTCCTGTGGAGG + Intergenic
1049570633 8:143368840-143368862 CCCGACTGTCCCTCCTGAGTGGG - Intronic
1049836662 8:144739781-144739803 CCCGCCTCAGCCTCCTGAGTGGG - Intronic
1049897225 9:119359-119381 CCCGCCTCAGCCTCCTGAGTAGG + Intergenic
1051237099 9:15012936-15012958 CCCGTCTCGGCCTCCTGAGTAGG + Intergenic
1053740327 9:41129624-41129646 CCCGCCTCAGCCTCCTGAGTAGG + Intergenic
1054146814 9:61568265-61568287 CCCGCCTCAGCCTCCTGAGTAGG - Intergenic
1054443292 9:65285617-65285639 CCCGCCTCAGCCTCCTGAGTAGG + Intergenic
1054466553 9:65499318-65499340 CCCGCCTGAGCCTCCCGAGTAGG - Intergenic
1054486988 9:65735884-65735906 CCCGCCTCAGCCTCCTGAGTAGG - Intergenic
1054688022 9:68301689-68301711 CCCGCCTCAGCCTCCTGAGTAGG - Intergenic
1055128487 9:72747705-72747727 CCTGACTCAGCCTCCTGAGTAGG + Intronic
1057298039 9:93860780-93860802 CCAGGCTGTCCCTCTTGGGTGGG + Intergenic
1061011030 9:127954819-127954841 CCCCCCGGTTCCTCCTGAGTTGG + Intronic
1061112889 9:128587955-128587977 CCTGACTCAGCCTCCTGAGTAGG + Intronic
1062426738 9:136509561-136509583 CCGACCTGTCCCTCCTGAGAGGG - Intronic
1186843172 X:13505538-13505560 CCTCTCAGTCCCTCCTGAGTGGG + Intergenic
1187390342 X:18882596-18882618 CCTGACTCTCCCTCCTTGGTTGG + Intergenic
1187805964 X:23121072-23121094 CCCGCCTCAGCCTCCTGAGTAGG + Intergenic
1187891888 X:23944040-23944062 CCCGCCTCAGCCTCCTGAGTAGG - Intergenic
1190246490 X:48694191-48694213 CCTGCCTCTGCCTCCTGAGTAGG - Intergenic
1190681660 X:52831311-52831333 CCCCACTGTCCCTGCAGACTTGG + Intergenic
1196337120 X:114550328-114550350 CCCGCCTCAGCCTCCTGAGTAGG - Intergenic
1201533326 Y:15016769-15016791 CCCAACTCAGCCTCCTGAGTAGG + Intergenic
1201713187 Y:17014440-17014462 CCTGACTCAGCCTCCTGAGTAGG - Intergenic