ID: 1049574082

View in Genome Browser
Species Human (GRCh38)
Location 8:143382475-143382497
Sequence CTAAGGAGCCAGAGGGAGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 505}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049574071_1049574082 4 Left 1049574071 8:143382448-143382470 CCCGTCCTGCTGGGCCCCAGGGG 0: 1
1: 0
2: 3
3: 60
4: 479
Right 1049574082 8:143382475-143382497 CTAAGGAGCCAGAGGGAGCATGG 0: 1
1: 0
2: 4
3: 47
4: 505
1049574073_1049574082 3 Left 1049574073 8:143382449-143382471 CCGTCCTGCTGGGCCCCAGGGGG 0: 1
1: 0
2: 3
3: 56
4: 474
Right 1049574082 8:143382475-143382497 CTAAGGAGCCAGAGGGAGCATGG 0: 1
1: 0
2: 4
3: 47
4: 505
1049574067_1049574082 11 Left 1049574067 8:143382441-143382463 CCGCCGGCCCGTCCTGCTGGGCC 0: 1
1: 0
2: 3
3: 33
4: 359
Right 1049574082 8:143382475-143382497 CTAAGGAGCCAGAGGGAGCATGG 0: 1
1: 0
2: 4
3: 47
4: 505
1049574075_1049574082 -1 Left 1049574075 8:143382453-143382475 CCTGCTGGGCCCCAGGGGGCTTC 0: 1
1: 0
2: 6
3: 35
4: 370
Right 1049574082 8:143382475-143382497 CTAAGGAGCCAGAGGGAGCATGG 0: 1
1: 0
2: 4
3: 47
4: 505
1049574062_1049574082 27 Left 1049574062 8:143382425-143382447 CCCTGCTGCAGGGGGACCGCCGG 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1049574082 8:143382475-143382497 CTAAGGAGCCAGAGGGAGCATGG 0: 1
1: 0
2: 4
3: 47
4: 505
1049574068_1049574082 8 Left 1049574068 8:143382444-143382466 CCGGCCCGTCCTGCTGGGCCCCA 0: 1
1: 0
2: 11
3: 26
4: 404
Right 1049574082 8:143382475-143382497 CTAAGGAGCCAGAGGGAGCATGG 0: 1
1: 0
2: 4
3: 47
4: 505
1049574077_1049574082 -10 Left 1049574077 8:143382462-143382484 CCCCAGGGGGCTTCTAAGGAGCC 0: 1
1: 0
2: 3
3: 17
4: 153
Right 1049574082 8:143382475-143382497 CTAAGGAGCCAGAGGGAGCATGG 0: 1
1: 0
2: 4
3: 47
4: 505
1049574064_1049574082 26 Left 1049574064 8:143382426-143382448 CCTGCTGCAGGGGGACCGCCGGC 0: 1
1: 0
2: 0
3: 10
4: 198
Right 1049574082 8:143382475-143382497 CTAAGGAGCCAGAGGGAGCATGG 0: 1
1: 0
2: 4
3: 47
4: 505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049574082 Original CRISPR CTAAGGAGCCAGAGGGAGCA TGG Exonic
900162103 1:1228714-1228736 CCCAGGAGCCAGAGGCAGCACGG + Exonic
900898932 1:5503873-5503895 ATCAGGAGGCAGAGGGAGCCGGG - Intergenic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901161381 1:7178686-7178708 GTAAAGAGCTAGAGGGAGAAGGG + Intronic
901756493 1:11444552-11444574 CCAAGGAGGCAGAGAGAGGAAGG - Intergenic
901928860 1:12584057-12584079 CATAGGAGCCAGAGGTAGGATGG - Intronic
902411722 1:16215814-16215836 CTAGGGAGCCAAAGTGAACATGG - Intergenic
902692674 1:18119724-18119746 CCAGCGAGCCAGAGGGGGCAAGG + Intronic
903218545 1:21856030-21856052 CACAGGAGCCAGAGGGAGCTTGG + Intronic
903544669 1:24116537-24116559 CTAAGGAGGAAGGGGGAGTAAGG - Intergenic
903737382 1:25538669-25538691 CTAGGGAGTCAGAGGGAGCCTGG - Intergenic
904353013 1:29921133-29921155 CTATGGAGCCAGACAGACCAGGG + Intergenic
904383640 1:30127737-30127759 CTAAAGAATCAGAAGGAGCATGG - Intergenic
905300249 1:36982053-36982075 TTCAGGAGCCGGAGGGAGTAGGG - Intronic
905723603 1:40228910-40228932 CTGAGGAGGCAGAGGCAGCGGGG - Intronic
905814649 1:40939888-40939910 CTCTGGAGCCAGAGTGAGTAGGG - Intergenic
906082565 1:43102744-43102766 CCATGGAGCCTGAGGGAGCAGGG - Intergenic
906291039 1:44619318-44619340 CAAAGAAGCCAGAGGGAGGCTGG + Intronic
906521410 1:46469087-46469109 CTATGGAGCTAGAGGGAGTGAGG + Intergenic
906854643 1:49291802-49291824 CCACAGAGCCAGAGGGAGCCAGG + Intronic
907333149 1:53684391-53684413 CCCAGGAGTCAGAGGGAGCAGGG - Intronic
907994892 1:59620074-59620096 TTATGGAGTCAGAGGGAGGAAGG + Intronic
908310801 1:62880944-62880966 CTAAGCAGCCAAAGGGAAAATGG - Intergenic
908406673 1:63821011-63821033 ATAAGGAGCCTCTGGGAGCAAGG + Intronic
909531110 1:76682664-76682686 TTAAAGAGCCAGATGGTGCATGG + Intergenic
910672132 1:89784060-89784082 CTCAGGAGGCAGAGGAAGGATGG + Intronic
911083818 1:93959568-93959590 CTACGCAACCAGAGGGAGGAGGG - Intergenic
911121283 1:94299742-94299764 TAAGGGAGCCAGAGGGAGGAAGG + Intergenic
911318920 1:96388341-96388363 TTAAGAAGCCAGACAGAGCAGGG + Intergenic
911439282 1:97905243-97905265 CTAAAGATGCAAAGGGAGCAAGG + Intronic
911973336 1:104463515-104463537 ATCAGGTGCCTGAGGGAGCAAGG + Intergenic
912435816 1:109660296-109660318 CTAAGGATTCAGAGAGAGCCAGG - Intronic
913401882 1:118444429-118444451 CTAAGGATGCAGAGGGAGCTAGG + Intergenic
914693943 1:150058399-150058421 CTCAGGAGGCTGAGGGAGGAGGG + Intergenic
914724441 1:150315922-150315944 AGAAGGATCCAGAGGGAGGAAGG - Intergenic
915149579 1:153819717-153819739 CTAGTGAGCCAGAGCGAGGAAGG - Exonic
915407583 1:155673121-155673143 CTCAGGAGGCAGTGGGAGGATGG - Intronic
915728281 1:158034163-158034185 CTCAGGAGGCTGAGGGAGAATGG + Intronic
916041616 1:160966251-160966273 CTCAGGAGCCTGAGGGTGGAAGG + Intergenic
916303492 1:163302598-163302620 CAAGGGAGCCAGAGGTAGGAGGG - Intronic
916413623 1:164572585-164572607 CTAGTGTGACAGAGGGAGCATGG + Intronic
916626651 1:166565335-166565357 CTATGGAGAAAGATGGAGCAGGG - Intergenic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
917539566 1:175899694-175899716 TAAAGGAGACAGAGGGAGGATGG + Intergenic
918070457 1:181130330-181130352 CCGAGGAGCCATGGGGAGCAGGG + Intergenic
918082139 1:181215903-181215925 CCAAGGAGGCAGAGGTTGCAGGG - Intergenic
918407136 1:184222515-184222537 GTAAGGGGCCAGAGTGGGCATGG - Intergenic
918629891 1:186704173-186704195 CGAAGGAGCCAGTGCAAGCAAGG + Intergenic
919804174 1:201371079-201371101 CCTAGGAGCCATGGGGAGCAAGG + Intronic
920313577 1:205062380-205062402 CACAGGAGCCACAGGGAGGAGGG - Intronic
920545912 1:206818110-206818132 ATAAGGAGGCAGAGTTAGCAAGG + Intronic
920919311 1:210285092-210285114 TGAAGCTGCCAGAGGGAGCAAGG - Intergenic
921044781 1:211467717-211467739 CTTAGGAGGCTGAGGCAGCATGG + Intergenic
921155484 1:212434953-212434975 GGAAGGAGCCAGAGAGAGGAGGG + Intronic
921199544 1:212792001-212792023 ATACGGGACCAGAGGGAGCAGGG + Intronic
921931169 1:220755454-220755476 GTCAGGAGGCAGAGGGAGCAGGG + Intronic
921990353 1:221359525-221359547 CTAAGGAGGCAGAGAGCACATGG - Intergenic
922867968 1:228876529-228876551 CTAAGGAGCCTCAGAGAGCTAGG + Intergenic
923220815 1:231891462-231891484 GTCAGGAGACAGACGGAGCAGGG + Intronic
923498116 1:234542375-234542397 GTCAGGAGCCAGAGGGAGAGTGG - Intergenic
923600416 1:235397996-235398018 CAAAGCAGACAGAAGGAGCAAGG - Intronic
923625029 1:235606783-235606805 CTCATGGGCCAGGGGGAGCATGG + Intronic
923652112 1:235883701-235883723 CCAAAGAGCCAGAGGGAGAGAGG - Intergenic
924072378 1:240294717-240294739 CTCAGCAGCCAGAGGGAGCAGGG - Intronic
924600199 1:245482165-245482187 CTCAGGAGGCAGAGGTTGCAGGG - Intronic
924886954 1:248229213-248229235 CTAGGGAACCAGCAGGAGCAGGG + Intergenic
1063422993 10:5928502-5928524 CTAAAGAGTGAGAGGGAGGAAGG - Intronic
1063623796 10:7671116-7671138 TTAAGGAGACAGAGGAAGGAGGG + Intergenic
1063789461 10:9425465-9425487 GTCAGGAGGCAGAGGGAGCGGGG + Intergenic
1064984398 10:21195657-21195679 CTAAGGAGAGAGAGGGAGGGAGG - Intergenic
1065407763 10:25388683-25388705 CCATGGAGCCAGTGGGAGCTGGG + Intronic
1065450853 10:25855465-25855487 CTGATGAGCCAGAGACAGCAGGG + Intergenic
1065550041 10:26860895-26860917 TTAAAGAGACAGAGGCAGCAAGG + Exonic
1067234929 10:44439393-44439415 ATAAGGAGAGAGAGGGAGCACGG - Intergenic
1067314128 10:45145280-45145302 AGAAGGAGACAGAGGGAGAAGGG + Intergenic
1067828154 10:49594230-49594252 CCAAGGACCAACAGGGAGCAGGG + Intergenic
1068222863 10:54064951-54064973 CCAGGGAGCCGGTGGGAGCAAGG - Intronic
1068443833 10:57095230-57095252 CGAAGGAGACTGAGGCAGCAGGG - Intergenic
1068906383 10:62328894-62328916 CTAAGCTGCCAGAAAGAGCATGG - Intergenic
1069001751 10:63274487-63274509 CCCAGGAGCCAGAGGTTGCAGGG + Intronic
1069430179 10:68327596-68327618 CCCAGGAGCCAGAGGTTGCAGGG + Intronic
1069957787 10:72062257-72062279 CTCAGAAGCAAGAGGGAGAAGGG + Exonic
1070700507 10:78598406-78598428 ACAAGGTGCCGGAGGGAGCAGGG - Intergenic
1070799977 10:79239615-79239637 CTAAGCGGTCAGAGGGAGCCTGG + Intronic
1070811439 10:79300166-79300188 CTAAGGAGCGTGGGTGAGCAGGG - Intronic
1071061004 10:81570851-81570873 CTACAGAGCCAGTGGGAGCCAGG - Intergenic
1071601302 10:86959862-86959884 CCCTGGAGTCAGAGGGAGCAGGG + Intronic
1071773378 10:88755613-88755635 CCAAGGAGCCAAAGAGAGAATGG + Intergenic
1072268298 10:93751495-93751517 GTCAGGGGCCCGAGGGAGCAAGG - Intergenic
1072476168 10:95761848-95761870 CCAGGGAGCTAGAGGTAGCAGGG + Intronic
1072908772 10:99481360-99481382 CTAAGGAGACTGAGGGAACCCGG - Intergenic
1075230333 10:120671191-120671213 CCTGGGAGCCACAGGGAGCAAGG + Intergenic
1075614407 10:123881085-123881107 CCAAGGGGCCAGCAGGAGCATGG - Intronic
1075714495 10:124548241-124548263 CACAGGAGGCAGAGGCAGCATGG - Intronic
1076883623 10:133251614-133251636 CTGGGGAGCCACAGGGAGCTCGG - Intergenic
1077037259 11:501402-501424 CTAAGGAGACAGAGGGCTGAGGG + Intronic
1077378194 11:2215496-2215518 AGGAGTAGCCAGAGGGAGCACGG + Intergenic
1077456369 11:2683709-2683731 CTAGGTAACCAGAGGGAGTAAGG - Intronic
1077938729 11:6817855-6817877 CTAAGGAGCCAGCAGGAGCCAGG + Intergenic
1078520842 11:12061696-12061718 CTCAGGGTTCAGAGGGAGCATGG + Intergenic
1078722362 11:13896887-13896909 CTGAAGAGCCAGAGAGGGCAGGG - Intergenic
1078861037 11:15246722-15246744 CAAAGAAGCCAAAGGAAGCAGGG - Exonic
1079165944 11:18043527-18043549 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
1080181455 11:29431175-29431197 TTTGGGAGGCAGAGGGAGCAAGG - Intergenic
1080401614 11:31941612-31941634 GTCAAGAGGCAGAGGGAGCAAGG + Intronic
1082100030 11:48165078-48165100 TTAATGAGTCAGAGGCAGCAAGG - Intronic
1083463313 11:62829654-62829676 CTGAGGAGCCTGAGGCAGGAGGG + Intronic
1083895180 11:65616229-65616251 CTCAGGCGCCAGACGGGGCATGG + Exonic
1083915942 11:65743951-65743973 CCAAGGGGCCAGCGGGAGCTGGG + Intergenic
1083950626 11:65953678-65953700 CTACGCACCCAGAGGGAGCCGGG + Exonic
1084436641 11:69145998-69146020 GTCAGGAGGCAGAGGGAGCAGGG - Intergenic
1084656270 11:70521005-70521027 CTCAGGAGCCAGTGTGAGGAAGG - Intronic
1084887962 11:72223255-72223277 TTAAGGAGCCAGGGGGCGGAGGG + Intergenic
1084952297 11:72673527-72673549 CTACGGAGCCAGATGGAATATGG - Intronic
1086249175 11:84794395-84794417 CCATGGAGCCAGTGGGAGCTGGG + Intronic
1087339056 11:96878877-96878899 CCATGGAGCCAGTGGGAGCCAGG - Intergenic
1087407927 11:97752654-97752676 CAAAGGAGTCTGAGGTAGCAAGG + Intergenic
1087453537 11:98353957-98353979 CCATGGAGCCAGAGGCAGCTGGG - Intergenic
1088304225 11:108391057-108391079 AAAAGAAGCCAGAGGAAGCAGGG - Intronic
1088318433 11:108530748-108530770 CTAAAGGGCCAGAGGGTGCCTGG + Intronic
1088576730 11:111279443-111279465 CAGAGGCTCCAGAGGGAGCATGG - Intronic
1089279906 11:117366582-117366604 CAAAGGAGCAGGAGGGAGCCTGG + Intronic
1089825192 11:121268781-121268803 CTAAGGAGGAAGCGGGGGCAGGG + Intergenic
1090574668 11:128087799-128087821 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
1091020796 11:132097810-132097832 TAAAGGAGCCAGAGGGAAAAGGG + Intronic
1091215340 11:133898025-133898047 ATCAGGAGCCAGTGGGAGGAAGG + Intergenic
1092897655 12:13028902-13028924 TTCTGAAGCCAGAGGGAGCAAGG - Intergenic
1093480562 12:19600177-19600199 CTCAGGTGGCAGAAGGAGCAAGG - Intronic
1094017931 12:25884371-25884393 CCATGGAGCCAGTGGGAGCCAGG + Intergenic
1095485731 12:42682722-42682744 CTCAGGAACCAGAGGTTGCATGG + Intergenic
1095977599 12:47950264-47950286 CCAAGAGGACAGAGGGAGCAAGG + Intergenic
1096649679 12:53055886-53055908 CTAAGGGGCCAGCTGGAGAAAGG - Intronic
1096708879 12:53441151-53441173 TGAAGGAGGCAGAGGGATCACGG + Intergenic
1096758341 12:53818526-53818548 CTAAGGAGCCAAATGTTGCAGGG - Intergenic
1096966135 12:55629561-55629583 ATCGGGAGACAGAGGGAGCAAGG + Intergenic
1098147959 12:67516900-67516922 ATAAGGAAACAGAGGGAACAGGG + Intergenic
1098290973 12:68956411-68956433 CCATGGAGCCAGTGGGAGCCGGG - Intronic
1099334990 12:81344153-81344175 GTCAGGAGGCAGAAGGAGCAGGG - Intronic
1099574409 12:84362169-84362191 CCAAGGAGCCAGCGGGAGACAGG + Intergenic
1099638725 12:85254097-85254119 AGAAGGAGCAAGAGAGAGCAAGG - Intronic
1102044662 12:109822300-109822322 CTAAGGAGCCCCAGGGTGGAGGG - Intronic
1103152384 12:118652001-118652023 CTAAGCAGAGAGAGGGAGAAGGG + Intergenic
1103191542 12:119006143-119006165 CAAAGGAGGCAGAGAGAGAACGG - Intronic
1103442414 12:120973285-120973307 CCAGGGAGCCAGAGGAACCAAGG - Intergenic
1103493414 12:121341392-121341414 CCCAGGAGGCAGAGGTAGCAGGG + Intronic
1103954302 12:124567728-124567750 TTAAGGAGCCAGAGGGGGCCGGG - Intergenic
1104404852 12:128508776-128508798 CTGAGCAGCTGGAGGGAGCACGG - Intronic
1104742389 12:131188279-131188301 CTATGGAGCCAGTGGGAGCCAGG + Intergenic
1105507628 13:21023895-21023917 CCCAGGAGGCAGAGGTAGCAGGG + Intronic
1106598857 13:31170329-31170351 CTAACCAGCAAGAGGGAGCCAGG + Intergenic
1106633126 13:31498056-31498078 GACAGGAGGCAGAGGGAGCAAGG + Intergenic
1106826924 13:33533037-33533059 CTAAGTGGCCAGTGGGAGAAAGG + Intergenic
1107182105 13:37473031-37473053 AGAAGGAACCAGAGGGAGCAGGG - Intergenic
1107293797 13:38888370-38888392 GTCAGGAGGCAGAGGGAGCTAGG + Intergenic
1108592974 13:51926746-51926768 CTAAGGTGGGACAGGGAGCAAGG + Intergenic
1109149271 13:58823925-58823947 CAAAGGCGCGGGAGGGAGCAGGG - Intergenic
1109348353 13:61145002-61145024 CCATGGAGCCAGTGGGAGCCAGG + Intergenic
1112285930 13:98104473-98104495 GGCAGGAGGCAGAGGGAGCAGGG + Intergenic
1112478910 13:99755944-99755966 CTTAGGAGGCAGAGTGAGAAAGG - Intronic
1112838657 13:103548284-103548306 CTCAGAGGCAAGAGGGAGCATGG - Intergenic
1113141612 13:107158347-107158369 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
1113439331 13:110315469-110315491 CTCAGGAGGCAGAGGTTGCAGGG - Intronic
1114205080 14:20563404-20563426 ATAAGGACCCAGAGGAAGGAAGG - Intergenic
1114263930 14:21060074-21060096 ATAAGGAGGCAGAGATAGCATGG - Intronic
1114393802 14:22338439-22338461 CTATCAAGCCTGAGGGAGCATGG + Intergenic
1114578127 14:23731546-23731568 CTAAGGAGCATGAGGGAGTGTGG + Intergenic
1115598629 14:34934064-34934086 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
1115753980 14:36515753-36515775 CAAAGGAGCCAAAAGCAGCAGGG + Intergenic
1118198253 14:63648327-63648349 CAGAGGAGCCAGAGGTTGCATGG + Intergenic
1118208401 14:63744596-63744618 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
1118332200 14:64823484-64823506 CCTGGGAGCCAGAGGCAGCAGGG + Intronic
1118400751 14:65377213-65377235 CTAGGGAGCTAGAGGGAGTTTGG - Intergenic
1118947296 14:70399359-70399381 CCATGGAGCCAGTGGGAGCCAGG - Intronic
1119127568 14:72141840-72141862 CTAAGGAACCATAAGGAACATGG - Intronic
1119568691 14:75650742-75650764 GTAAGGAGCCGGAGGCAGCCAGG + Exonic
1120161846 14:81154190-81154212 CTAAGGAGGCTGAGGCAGAAGGG + Intergenic
1120473643 14:84959222-84959244 CTAAGGAGCCAAAGAGCCCATGG - Intergenic
1121141296 14:91544973-91544995 CCCAGGAGGCAGAGGGTGCAGGG - Intergenic
1121320754 14:92990373-92990395 ATAAGGAGCTAGAAGGAGCCAGG + Intronic
1121432867 14:93899860-93899882 CTAGGGAGGGAGAGGGAGGAGGG + Intergenic
1121567676 14:94923002-94923024 CTATGGATCCAGAGGGAGCTGGG - Intergenic
1121734688 14:96209918-96209940 CTCAGGAGGCAGAGGTTGCAGGG + Intronic
1121736880 14:96224965-96224987 TTCAGAAGCCACAGGGAGCAAGG + Intronic
1121998709 14:98628032-98628054 CTAAAGTCTCAGAGGGAGCATGG + Intergenic
1122082982 14:99279817-99279839 CTTAGGGATCAGAGGGAGCATGG - Intergenic
1122268589 14:100558203-100558225 GTAAGGAGGCAGAGGCAGAAAGG - Intronic
1122778142 14:104131930-104131952 CTAAGGAGGGAGAGGAAACATGG + Intergenic
1122942744 14:104989718-104989740 CCAAGGCCCCAGAGGGAGGAGGG + Intronic
1122966006 14:105126366-105126388 CCAAGGAGCCAGCAGGAGCCAGG + Intergenic
1124394950 15:29293353-29293375 CTCAGGAGGCTGAGGGAGAATGG - Intronic
1125236843 15:37524618-37524640 CAGAGGCTCCAGAGGGAGCATGG - Intergenic
1125584649 15:40811627-40811649 TTAAGGAGGCAGAGGCAGGAGGG + Intronic
1125591799 15:40858913-40858935 CCAAGGTCACAGAGGGAGCATGG - Intergenic
1125595345 15:40881867-40881889 CTCAGGAGGCAGAGGTTGCAGGG - Intergenic
1126109062 15:45165266-45165288 GTAAGGATGCAGTGGGAGCATGG + Exonic
1127054804 15:55120722-55120744 CAAATGAAACAGAGGGAGCAAGG - Intergenic
1127299297 15:57637083-57637105 CTAAGGAGGAGGAGGCAGCAGGG - Intronic
1127846331 15:62874809-62874831 CTCTGGAGGCAGAGAGAGCAGGG - Intergenic
1128349543 15:66879891-66879913 CTGGGGAGCCAGAGGGAGATGGG - Intergenic
1128472807 15:67969100-67969122 CTGAGGTGCCAGATGGCGCAGGG + Intergenic
1128627754 15:69228760-69228782 CCAAGGAGGCAGAGGTTGCAGGG - Intronic
1128864418 15:71103461-71103483 CCAAGGAGCCAGAGGGTGTTGGG - Intronic
1129045754 15:72732780-72732802 ATCAGGAGGTAGAGGGAGCAAGG + Intronic
1129206295 15:74038872-74038894 AGAAGGAGCGAGAGGCAGCAGGG + Intronic
1129377867 15:75145471-75145493 CCAAGGAGCCAGTGAGAGCCAGG - Intergenic
1129731619 15:77935677-77935699 CTGAGGTGCCTGAAGGAGCAGGG - Intergenic
1129968447 15:79757181-79757203 CCCAGGAGGCAGAAGGAGCAGGG + Intergenic
1130043595 15:80426907-80426929 CTCACGTGGCAGAGGGAGCAGGG + Intronic
1131010859 15:89017414-89017436 CCTAGGTGCCAGAGTGAGCAGGG + Intergenic
1131387144 15:92017325-92017347 CTAAGTAGCAAAAGGAAGCAGGG + Intronic
1131442683 15:92470858-92470880 ACAGGGAGCCAGAGGGAGGAGGG - Intergenic
1131553099 15:93374744-93374766 ATAAGGAGGCAGAGGCAGGATGG + Intergenic
1131558852 15:93422419-93422441 CTAAGAACCCAAAGGGACCAAGG - Intergenic
1131890282 15:96965131-96965153 CTCAGGAGCCGGTGGGAGCTGGG + Intergenic
1131965783 15:97840817-97840839 GTAAGGAGGGAGAGTGAGCAAGG + Intergenic
1135060425 16:19266857-19266879 CTAGGGAGCCAGAGGGTTGAGGG - Intronic
1135208126 16:20499683-20499705 CCATGGAGCCAGCGGGAGCCAGG + Intergenic
1135210773 16:20524017-20524039 CCATGGAGCCAGCGGGAGCCAGG - Intergenic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136547737 16:30965134-30965156 CTGGGGAGCCAGAGCGGGCAGGG - Exonic
1136640820 16:31563748-31563770 TTAGGGAGACAGAGGGGGCAGGG - Intergenic
1136664145 16:31793566-31793588 TTAGGGAGACAGAGGGGGCAGGG + Intronic
1137453527 16:48599320-48599342 CTAAGGAGCTAATGGGGGCATGG + Intronic
1137998430 16:53246622-53246644 CTAAGGAGGCTGAGGCAGAAGGG - Intronic
1138131480 16:54483662-54483684 CAAAGGAGGCAGAGAGATCATGG + Intergenic
1138216336 16:55208057-55208079 CCCAGGAGCCAGGGGGAGCTGGG - Intergenic
1139308826 16:66011196-66011218 CCCAGGAAACAGAGGGAGCATGG - Intergenic
1139440042 16:66962030-66962052 GCCAGGAGGCAGAGGGAGCAGGG + Intronic
1140242604 16:73217139-73217161 CAGATGAGTCAGAGGGAGCAGGG + Intergenic
1140434549 16:74935512-74935534 CTAAGGGGTCAGCTGGAGCAAGG - Intronic
1140645595 16:77026595-77026617 CTCAGGAGCCTGAGGTAGGAGGG - Intergenic
1140668272 16:77248066-77248088 CTAAAGTCCAAGAGGGAGCAAGG + Intronic
1140758873 16:78093094-78093116 CTAGGGAGCCAGAGGCAAGAAGG - Intergenic
1140947548 16:79784061-79784083 CTTTGGACCCAGAGGGACCAGGG - Intergenic
1142869317 17:2809921-2809943 CAGAGGAGCCAGCGGGAGGAAGG - Intronic
1143317365 17:6042547-6042569 CTGAGAAGCCAGAGGGTGTAAGG + Intronic
1143863985 17:9910832-9910854 CTAGGCAGCCAGAGGGTGGAAGG + Intronic
1144241638 17:13318560-13318582 CTAAGGAGCAAGTGGGAACAGGG - Intergenic
1145368487 17:22286684-22286706 CTATGGAGCCAGTGGCAGCTGGG + Intergenic
1147040946 17:37718585-37718607 CTTAGGAGGAAGAGGGAGAAGGG - Intronic
1147321683 17:39650362-39650384 GGAAGGGGTCAGAGGGAGCACGG + Intronic
1147735253 17:42633358-42633380 GTAAGAAGCCAGAGGGGGCCGGG + Intergenic
1148401399 17:47364874-47364896 CTAAGAAGGCACAGAGAGCAAGG - Intronic
1149076153 17:52597728-52597750 GTCAGGTGCCTGAGGGAGCAGGG - Intergenic
1149256980 17:54837363-54837385 CCATGGAGCCAGTGGGAGCTGGG - Intergenic
1150135495 17:62692901-62692923 AGAAGGGGCGAGAGGGAGCAGGG - Exonic
1150883186 17:69054417-69054439 CTAAGGAGGCTGAGGTAGAAAGG + Intronic
1151346038 17:73501919-73501941 CTAAGGTGACAGAGCTAGCAGGG + Intronic
1151484338 17:74389181-74389203 CTCATGAGCCAGAAGGAGAAGGG + Intergenic
1152140236 17:78532231-78532253 GTCAGGAGGCAGAGGGAGCTGGG - Intronic
1152509365 17:80774982-80775004 CCCAGGAGCCCGAGGGAGGAAGG - Intronic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1153469754 18:5430669-5430691 CTCAGGAGGCTGAGGGAGGAGGG - Intronic
1153744834 18:8167092-8167114 CAAAGGAGCCAGAGGCACCCAGG - Intronic
1153915638 18:9741908-9741930 CCAGGGACCCAGAGGGAGCCAGG + Intronic
1154181371 18:12142547-12142569 CTATGGAGCCAGTGGCAGCTCGG - Intergenic
1154182533 18:12149037-12149059 CTATGGAGCCAGTGGCAGCTCGG + Intergenic
1157331707 18:46708754-46708776 GTAAGGAGGCAGAGGGAGCGAGG - Intronic
1157807031 18:50665732-50665754 CCAAGGAGCCAGAGCCAGCTGGG - Intronic
1158719916 18:59915640-59915662 TTCAGGCGTCAGAGGGAGCATGG - Intergenic
1158774000 18:60555196-60555218 CTGTGGAGCCAGAAGGAGCTGGG + Intergenic
1160400314 18:78605964-78605986 CTTAGGATGCAGAGGGAGGATGG - Intergenic
1160694787 19:478232-478254 CTAAAGAGACAGAGGGGACAAGG + Intergenic
1161243520 19:3236066-3236088 CTGAGGAGCCACAGCCAGCAGGG + Intronic
1161571933 19:5035557-5035579 CCAAGGAGGCAGAGGGAGGGAGG - Intronic
1161752038 19:6105246-6105268 CTAAGGAGACAGAGAAAGCAGGG + Intronic
1161793603 19:6374567-6374589 CTAAGGATGTAGAGGGAGCCCGG - Exonic
1162602629 19:11680578-11680600 AGAAGGAGCAAGAGAGAGCAGGG + Intergenic
1162792599 19:13070739-13070761 TAAAGGAGCAAGTGGGAGCAAGG - Intronic
1162972435 19:14188709-14188731 CAAAGGAGCCAGAGGGCACTTGG - Intronic
1163212201 19:15849413-15849435 CTCAGGAGGCAGAGGCAGGAGGG - Intergenic
1163292998 19:16392932-16392954 CTAAGGAGGCTGAGGCAGAAAGG + Intronic
1163664224 19:18595449-18595471 CTCACGAGCCAGAGTGAGCTTGG + Intronic
1163689456 19:18730729-18730751 ATAAGGGCCCAGAGGGGGCAGGG - Intronic
1164481091 19:28611479-28611501 GTCAGGTGCCTGAGGGAGCAGGG - Intergenic
1164539662 19:29113487-29113509 TGAAGGGGCCTGAGGGAGCAAGG - Intergenic
1164580277 19:29430482-29430504 AGAGGGAGCCAGAGAGAGCAAGG - Intergenic
1164958100 19:32404627-32404649 CTCAGGAGGCTGAGGAAGCAGGG + Intergenic
1165040189 19:33063596-33063618 CTCAGGACCTAGAGGGAGGAAGG + Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1166277743 19:41766709-41766731 TTAAGGAGCCAAAGGGGGCCAGG + Intronic
1166320628 19:42016482-42016504 CTCAGGGGCCAGAGGGTGCATGG - Intronic
1166376122 19:42328120-42328142 CGAATGAGCCAGAGGCTGCAGGG + Intronic
1166417483 19:42606818-42606840 CTAAGGAGCAAAAGGAAGCCAGG - Intronic
1166515965 19:43447196-43447218 CCAAGCCGCCAGAGGGCGCATGG + Intergenic
1166650876 19:44574143-44574165 TTAAGGAATCAGAGGGACCAAGG - Intergenic
1166691891 19:44826891-44826913 CTCAGGAGGCTGAGGCAGCAGGG + Intergenic
1166806917 19:45492988-45493010 GGGAGGACCCAGAGGGAGCATGG - Intronic
1167728633 19:51236246-51236268 GTCAGGAAGCAGAGGGAGCAAGG + Intronic
925419696 2:3702486-3702508 CTCAGGAGGCAGATGGAGCTGGG - Exonic
925588949 2:5491156-5491178 GTCAGGATGCAGAGGGAGCAGGG + Intergenic
925803715 2:7627865-7627887 CTAAGGAGGAATATGGAGCAGGG - Intergenic
926748300 2:16178597-16178619 CACAGGAGCATGAGGGAGCAGGG - Intergenic
929548946 2:42876929-42876951 CCAAGGAGGCAGAGGTTGCAGGG - Intergenic
930262541 2:49164468-49164490 ATAAGGAGCCAGTGGGAAAATGG + Intergenic
931801754 2:65765528-65765550 CTGAGGAGCCAGAGAGAGCTGGG - Intergenic
932414362 2:71564793-71564815 GAAAGGAGGAAGAGGGAGCAGGG - Intronic
933124441 2:78586574-78586596 TTAAGGAGTCAGGGGGAACAGGG + Intergenic
933229426 2:79789349-79789371 TTAAAGTGCCAGAGGGAGAATGG + Intronic
933400274 2:81787693-81787715 CTAAGGGGACAGAGGAAACAAGG - Intergenic
933967154 2:87439603-87439625 CGAAGGAGCCTGAGTTAGCAGGG - Intergenic
934613314 2:95756330-95756352 CTCAGGAACCAGAGGGGCCATGG - Intergenic
934640020 2:96022365-96022387 CTAAGGGGCCAGAGGTCTCAAGG - Intronic
934647583 2:96068090-96068112 CTCAGGAACCAGAGGGGCCATGG + Intergenic
934793628 2:97083031-97083053 CTAAGGGGCCAGAGGTCTCAAGG + Intergenic
934840959 2:97623910-97623932 CTCAGGAACCAGAGGGGCCATGG + Intergenic
936085902 2:109469029-109469051 CTCAGGAGGCTGTGGGAGCAGGG + Intronic
936531638 2:113280091-113280113 CTAAGAAGCCAGTGGGAGGGGGG + Intergenic
936574966 2:113645302-113645324 CCCAGGTTCCAGAGGGAGCAAGG + Intergenic
937098005 2:119248222-119248244 CTGAGTTGCCAGAGGGAGGAAGG - Intronic
937939205 2:127272130-127272152 CTCAGGAGGCTGAGGCAGCAGGG - Intronic
938607661 2:132912546-132912568 CAAAGGAACCATAGGAAGCAGGG - Intronic
938758336 2:134400929-134400951 ATAAGGATCCAGAGGGACCTGGG + Intronic
939023028 2:136980873-136980895 CCCAGGAGCCACATGGAGCAAGG - Intronic
940386471 2:153079185-153079207 ATCAGGAGCTAGAGGGAGGAGGG + Intergenic
940905641 2:159167108-159167130 CTAAGGAGTCAGGGGAAGAAGGG + Intronic
941036678 2:160576351-160576373 CAAAGGAGACAGAGGGAGACAGG + Intergenic
942868176 2:180700179-180700201 CCAGGAAGCCAGAGGGAGCCAGG - Intergenic
943685897 2:190818050-190818072 GTTAGGAGGCAGAGAGAGCAAGG + Intergenic
944796304 2:203189492-203189514 CTCAGGAGGCTGAGGCAGCAGGG - Intronic
945123080 2:206478938-206478960 CTAATGGGCCACAGGGACCATGG - Intronic
945596839 2:211806255-211806277 CTAAGGAGAGAGAGACAGCAGGG + Intronic
946171160 2:217896557-217896579 CATAGGATTCAGAGGGAGCATGG + Intronic
946194535 2:218025108-218025130 CCAGGGAGTCAGAGGTAGCATGG - Intergenic
946533566 2:220602406-220602428 GTCAGGAGGCAGAGGGATCAAGG - Intergenic
946901790 2:224380081-224380103 CCCAGGAGCCAGAGGAACCAGGG - Exonic
947227285 2:227852699-227852721 CTAAGGAGAATGAGGTAGCATGG + Intergenic
947793246 2:232879459-232879481 CCAGGGGGCCAGCGGGAGCAGGG - Exonic
947812214 2:233011693-233011715 CTCAGGAGGCAGAGGCAGGAGGG - Intronic
948350923 2:237340270-237340292 TTTAGGAGCCAGAGTAAGCAGGG - Intronic
948587315 2:239027582-239027604 CTGAGGACCCAGGGCGAGCATGG + Intergenic
1168969310 20:1919862-1919884 GTCATGAGCCACAGGGAGCAGGG + Intronic
1169244921 20:4017562-4017584 TCAAGGAGCCAGATGGGGCAGGG - Intergenic
1169712410 20:8579848-8579870 ATCAGGAGACAGAGGGAGCAAGG + Intronic
1169746791 20:8951340-8951362 ATCAGGAGGCAGAGGGAGCAAGG + Intronic
1169915907 20:10683074-10683096 CTAACGAGCCAGAGGATGAAAGG + Intergenic
1169944544 20:10974773-10974795 CTCAGGAGGCAGAGGGAGATGGG - Intergenic
1171011817 20:21513157-21513179 TTAAGGAGAAAGAGGGAGAAGGG - Intronic
1172232854 20:33348608-33348630 CTGAGGAGCCAGAAGGAGCAGGG + Intergenic
1172853146 20:37981147-37981169 CTCAGGAGCCAGACAGAGCCAGG + Intergenic
1173831550 20:46092143-46092165 CGCAGGAGCCCGAGGGAGGAGGG - Intergenic
1174429616 20:50458374-50458396 CTCAGGAGGCTGAGGGAGAATGG + Intergenic
1175127137 20:56760736-56760758 CTAAGGGGCCAGAGGGGGCGGGG + Intergenic
1175382806 20:58575372-58575394 CTAGGGAGGCAGAGGTTGCAGGG + Intergenic
1175451480 20:59072444-59072466 CGAAGGTTTCAGAGGGAGCATGG + Intergenic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1178138772 21:29658336-29658358 CTCAGGAGGCAGAGGTTGCAGGG - Intronic
1178265852 21:31142102-31142124 GTCAGGAGGCAGAGGGAGCGAGG - Intronic
1178419856 21:32434734-32434756 CTAAGGAGCTGGAGGAAGCTGGG + Intronic
1180915450 22:19483056-19483078 CTAAGGAGGCTGAGGCAGGAAGG - Intronic
1181802693 22:25357919-25357941 CTCAGCACCCAGAGGGAGGAAGG + Intronic
1181888690 22:26042026-26042048 CTAAGGAGCCAGAGAAGGCGAGG + Intergenic
1182119761 22:27779104-27779126 CTCAGGGGCCAAAGGCAGCAGGG + Intronic
1182761501 22:32725970-32725992 GGAAGGAGCCAGAGCAAGCAGGG - Intronic
1183184416 22:36283949-36283971 GCAAGGAGCCAGAAGGGGCAGGG + Intronic
1183306033 22:37083733-37083755 CTTAGTTACCAGAGGGAGCAAGG + Intronic
1184696510 22:46142372-46142394 CTCAGGAGGCAGAGGCAGGAGGG + Intergenic
1184830312 22:46981964-46981986 CTAGGGAGCCAGATAGACCAAGG + Intronic
1184869573 22:47226562-47226584 CCATGGAGCCAGCGGGAGCCCGG - Intergenic
1185418637 22:50722924-50722946 CCAAGCCGCCAGAGGAAGCAAGG - Intergenic
1185425208 22:50765573-50765595 CCCAGGTTCCAGAGGGAGCAAGG - Intergenic
950135240 3:10576311-10576333 CTAAGCAGCCTGAGTGAGAAGGG - Intronic
950139258 3:10604040-10604062 GTATGGAGGCAGAGGGAGGAGGG - Intronic
950635879 3:14314164-14314186 TGAAGCAGGCAGAGGGAGCAGGG + Intergenic
950723294 3:14899773-14899795 TTAAGGAGACAGAGGGAACAGGG + Intronic
950837605 3:15935774-15935796 AAAAGGAAACAGAGGGAGCAAGG - Intergenic
951616021 3:24545042-24545064 CAAAGGATTCAGAGGGAGCATGG + Intergenic
952952926 3:38538963-38538985 CCAAGGTGCCACAGGGAGCGAGG - Intronic
953377606 3:42441856-42441878 CCAAGCAGCAAGAGGGAGGAAGG + Intergenic
954422523 3:50426128-50426150 CTCAGGAGCCAGGGTAAGCAAGG + Intronic
954447189 3:50553132-50553154 CTGAGGAGCCTGAGGGATCAGGG + Intergenic
954485269 3:50844321-50844343 CTCAGGAGGCTGAGGGAGGACGG - Intronic
954497859 3:50982659-50982681 CCACGGAGCCAGCGGGAGCCAGG + Intronic
954502415 3:51030850-51030872 CTAAGAAGCCAGAGAGAGGATGG - Intronic
956335197 3:68155511-68155533 CTAAGGAGTCACAGGGATTAGGG - Intronic
956902768 3:73733884-73733906 ATAAGGAGACAAAGGGACCACGG - Intergenic
957535972 3:81503998-81504020 CAAGGGAGCAAGAGAGAGCAAGG + Intronic
958128028 3:89382574-89382596 GTCAGGAGGCAGAGGGAGCAAGG + Intronic
958141936 3:89572119-89572141 CCATGGAGCCAGCGGGAGCCAGG - Intergenic
958655528 3:96997520-96997542 CCAAGGAGACAGAGAGAGAAGGG + Intronic
959817925 3:110697881-110697903 CTGAGTTTCCAGAGGGAGCATGG - Intergenic
960294788 3:115929822-115929844 CCAAGAAGCTAGAGGGTGCATGG - Intronic
960767922 3:121157941-121157963 CTGAGGAGCCAGTGAGAGAATGG + Intronic
960995055 3:123335240-123335262 GTCAGGAGGCCGAGGGAGCAGGG - Intronic
961006085 3:123406302-123406324 GTCAGGAGGCAGAGGGAGCCAGG - Intronic
961451484 3:127004195-127004217 CCAAGGAGCCAGAGTGAGCTGGG + Intronic
963046103 3:141103788-141103810 CTCAGGAGCCAGGCAGAGCAAGG + Intronic
963435761 3:145263544-145263566 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
963907211 3:150782593-150782615 CTGAGGGGCCAGGGAGAGCAAGG + Intergenic
964376625 3:156054617-156054639 CCAAGGAGGCAGAGGTTGCAGGG - Intronic
965288877 3:166850110-166850132 CCTGGGAGCCACAGGGAGCAAGG - Intergenic
967219473 3:187236570-187236592 GTAAGGAGAAAGAGGGAGCAGGG + Intronic
970246019 4:14064382-14064404 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
974019164 4:56677723-56677745 CTAAGGAGCCACAGACAGGAAGG + Intronic
975460767 4:74650976-74650998 CTCAGGAGGCTGAGGGAGGATGG + Intergenic
976104971 4:81606788-81606810 TTGAGGGGCCAGAGAGAGCATGG - Intronic
977751935 4:100620354-100620376 GTACAGAGACAGAGGGAGCAGGG + Intronic
977952600 4:102990811-102990833 CTAAGGAGACAGAGATATCAAGG + Intronic
978301147 4:107270542-107270564 CCATGGAGCCAGTGGGAGCTGGG - Intronic
978584283 4:110261040-110261062 CTAAGGAGGCAGGAGGGGCAGGG + Intergenic
978848237 4:113300798-113300820 GTAAAGAGCGAGAGGTAGCAAGG - Intronic
979145826 4:117246575-117246597 CAGAGGAGGCAGAGGGAACAGGG + Intergenic
979212346 4:118120318-118120340 CTCAGGAGGCAGAGGGAGCAGGG + Intronic
979448319 4:120840134-120840156 CCATGGAGCCAGTGGGAGCCAGG - Intronic
980738106 4:136917427-136917449 CTGTGGAGCCAGAGGGAGCCAGG + Intergenic
981944424 4:150324621-150324643 AAAAAGAGCCAGAGGTAGCAGGG + Intronic
981999772 4:151011520-151011542 CTCAGGAGGCAGAGGTTGCAGGG + Intronic
982432633 4:155339943-155339965 TTCAGGAGCCAGAGAGCGCAGGG - Intergenic
983125992 4:163950607-163950629 CCACGGAGCCAGCGGGAGCTGGG - Intronic
983714578 4:170764227-170764249 CTAAGGATACAGAAGAAGCAAGG + Intergenic
984102290 4:175500009-175500031 CCACGGAGCCAGTGGGAGCCAGG - Intergenic
985282367 4:188300119-188300141 CTGAGGAAGCAGAGGGAACAGGG - Intergenic
985591689 5:768794-768816 CCCAGGAGCCAGCCGGAGCAGGG - Intergenic
985609605 5:879753-879775 CCCAGGAGCCAGCCGGAGCAGGG - Intronic
986494005 5:8323388-8323410 CTGAGGAGCCAGGGAGACCATGG - Intergenic
986736005 5:10667750-10667772 CTGAGGCCCCAGAGGGAGCATGG - Intergenic
986920944 5:12679637-12679659 CTAAGGTTTCAGAGGGAGCATGG - Intergenic
989339037 5:40354114-40354136 CCATGGAGCCAGTGGGAGCTAGG + Intergenic
989571356 5:42948894-42948916 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
989716482 5:44468754-44468776 CAAAGGAGCTACTGGGAGCAAGG + Intergenic
990141348 5:52707903-52707925 CTATGGAGGCAGAGGGTGTATGG - Intergenic
990466314 5:56074866-56074888 CTTAGGAGGCTGAGGGAGGAGGG + Intergenic
990492240 5:56313897-56313919 CCCAGGAGCCAGAGGCAGGAGGG + Intergenic
990727677 5:58774658-58774680 CTAGGGAGGGAGAGGGAGTAGGG + Intronic
992181822 5:74205022-74205044 GTAAGGAAACAGAGAGAGCAGGG - Intergenic
992646794 5:78818930-78818952 CTAAGGAGCCAGAGAGGGCCAGG - Intronic
992693246 5:79259923-79259945 CCATGGAGCCAGTGGGAGCCAGG - Intronic
992758190 5:79928975-79928997 TTTAGGAGCCAGAGATAGCATGG - Intergenic
993532428 5:89041058-89041080 CTAAGAAGCCAGAGAGAGCTGGG + Intergenic
994916153 5:105982618-105982640 CAAAGGGGCCCGAGGCAGCAGGG - Intergenic
995423589 5:111993749-111993771 CTAAGGAGGTAGAGGAAACATGG - Intronic
995490565 5:112686927-112686949 CTAAGGAGCTAGAGGCAGAACGG + Intergenic
996001849 5:118373852-118373874 CTCAGAAGGCAGAGGGAGTAAGG - Intergenic
996273705 5:121639500-121639522 CTAAGGAGGGAGAGGGAGAATGG + Intergenic
996474919 5:123906526-123906548 CTCAGGAGACAGAGAGAGAAGGG + Intergenic
996834415 5:127775447-127775469 GTCAGGAGGCAGAGGGAGCAAGG - Intergenic
997681115 5:135751384-135751406 CTAAGGAACCACAGGGAGCAGGG - Intergenic
999247378 5:150162320-150162342 CCCAGGAGCCAGAGGAAGGAGGG + Intergenic
999290392 5:150421741-150421763 CTCAGGAGGCAGAGGTTGCAGGG - Intergenic
999537004 5:152528682-152528704 ATAAGGAGCCAGAAGGGGGATGG + Intergenic
999544593 5:152613235-152613257 CGAAGGAGCCAGGGGGAAGATGG + Intergenic
999887309 5:155937222-155937244 CTATGGAGCCAGTGGGAGCCGGG - Intronic
1000026373 5:157362595-157362617 CTAATGAGTGAGATGGAGCAGGG - Intronic
1001956408 5:175850930-175850952 CTGAGGAACCAGAGGCAGGAGGG + Intronic
1002062918 5:176637067-176637089 CTCAGAAGTCAGAGGGAGCAGGG - Intronic
1002703114 5:181141164-181141186 TTTAGGAGGCAGAGGGAGCTGGG - Intergenic
1002815333 6:675062-675084 GTCAGGAGGCAGAGGGAGCCAGG - Intronic
1003170547 6:3718683-3718705 GTCAGGAGGCAGAAGGAGCAGGG - Intergenic
1004010564 6:11681998-11682020 GTTAGCAGGCAGAGGGAGCAGGG + Intergenic
1004399204 6:15272905-15272927 TTAAAGAGCCAATGGGAGCAGGG - Intronic
1004891095 6:20101452-20101474 CCATGGAGGCAGAGGGATCATGG - Intergenic
1005043578 6:21620817-21620839 CCATGGAGCCAGTGGGAGCCCGG - Intergenic
1005416480 6:25605332-25605354 CTAAGAAGTCAGAGGGACAAGGG - Intronic
1005522083 6:26610526-26610548 CTACGAAGCCAGAGGGGGCCGGG + Intergenic
1005592470 6:27343258-27343280 CCAAGGAGGCAGAGGTAGCAGGG - Intergenic
1005665136 6:28044726-28044748 TTCAGGTGCCAGAGGGAGCATGG + Intergenic
1007487868 6:42194828-42194850 CTGAGGAGCATCAGGGAGCAAGG + Exonic
1007727739 6:43926869-43926891 CTCAGGCGGCAGAGGGAGGAGGG - Intergenic
1009847025 6:69146615-69146637 CCAAGGAGCCAGTGGTAGCTGGG - Intronic
1011795394 6:90947330-90947352 CCATGGAGCCAGCGGGAGCCGGG + Intergenic
1012298191 6:97550396-97550418 CTCAGGAGGCTGAGGGAGAATGG + Intergenic
1012611658 6:101226923-101226945 GTCAGGTGCCTGAGGGAGCAGGG + Intergenic
1013155377 6:107488394-107488416 CTAGGCAGCCACGGGGAGCAGGG + Intergenic
1014024171 6:116625727-116625749 CAAGGGAGTCAGAGGAAGCAAGG + Intronic
1014248303 6:119091059-119091081 ATAAAGAGCCAAAGTGAGCAGGG + Intronic
1014400828 6:120987596-120987618 ATCAGGAGACAGATGGAGCAGGG - Intergenic
1015201141 6:130582745-130582767 CTGAGGAGCAGGAGGGAGCTAGG + Intergenic
1017567351 6:155701665-155701687 CCCAGGAGCCACAGGGACCAGGG + Intergenic
1018739545 6:166717006-166717028 ATCCGGAGCCAGAAGGAGCAGGG + Intronic
1018799432 6:167210707-167210729 CCAAGTGGGCAGAGGGAGCAGGG + Intergenic
1018998640 6:168729165-168729187 CCAAGGCTCCCGAGGGAGCATGG - Intergenic
1019471332 7:1223040-1223062 CTAAGGATTCAGAAAGAGCAGGG - Intergenic
1020761106 7:12269288-12269310 CCATGGAGCCAGTGGGAGCCGGG + Intergenic
1021412954 7:20348801-20348823 ATAAGTAGCCAGTGGGAACAAGG + Intronic
1021540630 7:21753323-21753345 CTTAGTAGCCGGAGGCAGCATGG - Intronic
1023642430 7:42273429-42273451 AAAAGCAGCAAGAGGGAGCAAGG + Intergenic
1023682029 7:42696968-42696990 CTCTGAAACCAGAGGGAGCATGG + Intergenic
1023726422 7:43146772-43146794 ATCAGGAGCCAGTGGCAGCAGGG + Intronic
1024015734 7:45312399-45312421 CTTAGGAGTCAGGGGGAGTATGG + Intergenic
1024118322 7:46213353-46213375 CTCAGGAAGCAGAAGGAGCAGGG + Intergenic
1024781810 7:52859596-52859618 CTTAGGAGCCAGTGGAACCAAGG - Intergenic
1026418234 7:70205288-70205310 CTCAGGAGACAGAGGCAGGAGGG - Intronic
1028089799 7:86684609-86684631 CTAAAGAGCAAGAGGGATAATGG - Intronic
1031329290 7:120443997-120444019 CTAAGGAAACAGCAGGAGCAAGG - Intronic
1032544760 7:132732412-132732434 CAAAGCAGCCAGAGGGAGAACGG + Intergenic
1033266271 7:139889895-139889917 CTAAGGAGACATTGGGTGCAAGG + Intronic
1033423692 7:141224601-141224623 GTAAGGAGAGAGAGGCAGCAGGG + Intronic
1034221124 7:149447050-149447072 AGAAGGAGCCAGAGGAATCACGG - Intronic
1034550213 7:151815571-151815593 GGCAGGAGGCAGAGGGAGCAAGG - Intronic
1034977409 7:155456486-155456508 GGAAGGAGCCCGAGGGAGGAGGG + Intergenic
1037565212 8:20112286-20112308 CTAAGGAGCAAGAGGTGGCTGGG - Intergenic
1038055278 8:23852203-23852225 ACAAGCAGCCAGTGGGAGCAGGG + Intronic
1038321180 8:26528766-26528788 GGCAGGAGGCAGAGGGAGCAGGG + Intronic
1038975906 8:32695794-32695816 TTAAAGAATCAGAGGGAGCAAGG + Intronic
1039119499 8:34130019-34130041 GTAAGGAACCAGCAGGAGCAAGG + Intergenic
1039278420 8:35956497-35956519 GTCAGGTGCCTGAGGGAGCAGGG - Intergenic
1040349509 8:46550149-46550171 CCAAGGAGGCAGAGGTTGCAGGG + Intergenic
1041225429 8:55692726-55692748 ATCAGGAGGCAGAGGGAGGATGG - Intergenic
1041392676 8:57360620-57360642 AGAAGGAGGAAGAGGGAGCAGGG - Intergenic
1041955932 8:63558406-63558428 CCATGGAGCCAGTGGGAGCTGGG + Intergenic
1042420662 8:68584881-68584903 CTGTGGAGCCAGAGGGAGAAGGG - Intronic
1042856498 8:73273154-73273176 CCATGGAGCCAGTGGGAGCGAGG + Intergenic
1043404724 8:79918562-79918584 CTAAGGAGAAAAAGGAAGCAAGG - Intergenic
1043735155 8:83731522-83731544 CCACGGAGCCAGCAGGAGCAAGG - Intergenic
1049211964 8:141391134-141391156 CTCAGCAGCCAGAGGGACCCCGG - Intergenic
1049426470 8:142540134-142540156 CTAAATGACCAGAGGGAGCATGG - Intronic
1049446149 8:142632505-142632527 GTGAGGAGCCTGAGTGAGCAAGG - Intergenic
1049446547 8:142634089-142634111 GCGAGGAGCCAGAGGGAGAAGGG + Intergenic
1049574082 8:143382475-143382497 CTAAGGAGCCAGAGGGAGCATGG + Exonic
1049738674 8:144223522-144223544 CTGAGAAACCAGAGGGAGCCAGG - Intronic
1050354812 9:4772577-4772599 CTCAGGAGGCAGAGGCAGTAGGG - Intergenic
1050358501 9:4805083-4805105 CTCAGGAGCCCGAAGCAGCAGGG + Intronic
1050483837 9:6114047-6114069 CCATGGAGCCAGTGGGAGCTGGG + Intergenic
1050514716 9:6430790-6430812 GTCAGGAGGCAGAGGGAACAGGG - Intronic
1051029768 9:12659156-12659178 CCATGGAGCCAGCGGGAGCCAGG - Intergenic
1051185896 9:14461024-14461046 CTGAGGAACAAGAGGGTGCACGG - Intergenic
1051293283 9:15567759-15567781 CTAAGGAGGCTGAGGCAGGAGGG - Intronic
1054985920 9:71261964-71261986 GTCAGGAGCCACAGGGACCAGGG + Intronic
1055124683 9:72705489-72705511 CAAAGGAGGCAGAGGTCGCAGGG + Intronic
1055599558 9:77901515-77901537 CTAAGGAGGAAGAGGCAGGACGG - Intronic
1055667744 9:78569356-78569378 CCAGGGAGCCAGAGACAGCAGGG - Intergenic
1056388574 9:86119468-86119490 GTCAGGAGACAGAGGGAGCAAGG + Intergenic
1056658346 9:88526885-88526907 CTAAGGTTTCAGAGGGAGCACGG + Intergenic
1057175119 9:92991152-92991174 CTAGGGAGGCAGAGGTTGCAGGG - Intronic
1057745133 9:97745363-97745385 CTAAAGGACCAGATGGAGCATGG - Intergenic
1057813969 9:98280266-98280288 CAAGGGAGCCTGGGGGAGCAGGG - Intergenic
1059015328 9:110509616-110509638 CTTAGGAGACTGAGGCAGCAGGG - Intronic
1059077687 9:111211479-111211501 CCAAGGAGCCAAAGAGAGGATGG - Intergenic
1059394838 9:114027860-114027882 CTAGGCAGCAAGAGGAAGCAGGG - Intronic
1059966457 9:119619297-119619319 ATAAGGGGCCAGGTGGAGCAGGG - Intergenic
1060515070 9:124260467-124260489 CCCAGGAGGCAGAGGGTGCAGGG - Intronic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1060891661 9:127193105-127193127 GGAAGGAGCCAGAGAGAGAAGGG + Intronic
1061196447 9:129109721-129109743 CTACGGGGCCAGAGGGCGGAGGG - Intronic
1062406117 9:136397508-136397530 CTCAGAAGCTAAAGGGAGCATGG + Intronic
1062593340 9:137285130-137285152 CTAAGGAGGCTGAGGCAGAATGG - Intergenic
1185485842 X:481512-481534 GGAAGGAGACAGAGGGAGGAAGG + Intergenic
1185986062 X:4835519-4835541 TCAAGAAGCCAGTGGGAGCATGG + Intergenic
1186223825 X:7376257-7376279 CCATGGAGCCAGTGGGAGCTGGG - Intergenic
1186511738 X:10134901-10134923 CTAAGGAACAAGTGGAAGCAGGG + Intronic
1188829701 X:34881396-34881418 TTTAGGAGGCAGAGAGAGCAAGG + Intergenic
1190314739 X:49143279-49143301 GTCAGGTGCCTGAGGGAGCAGGG + Intergenic
1190496646 X:51033412-51033434 CTGAGGAGTCTGAGGGAGGATGG - Intergenic
1190509326 X:51160525-51160547 CTGAGGAGTCTGAGGGAGGATGG + Intergenic
1190621048 X:52287563-52287585 CAGAGGGGCCTGAGGGAGCAAGG - Intergenic
1190923139 X:54876348-54876370 CAAAGGAGGTAGAGGGAGAATGG - Intergenic
1192146568 X:68686639-68686661 ACAAGGAGGCAGAGGGAGCAGGG - Intronic
1192173692 X:68873046-68873068 CTGAGGCCCCAGAGGGAGAAAGG - Intergenic
1193997580 X:88385013-88385035 CTACAGAGCCCCAGGGAGCATGG + Intergenic
1194566201 X:95492464-95492486 CTCAGGAACCTGAGGGAGAAAGG - Intergenic
1195126360 X:101813198-101813220 CCATGGAGCCAGTGGGAGCAGGG + Intergenic
1196817524 X:119677158-119677180 CAAGGGACCCAGAGGAAGCACGG - Intronic
1198391363 X:136178518-136178540 CCCAGGAGGCAGAGGGTGCAGGG + Intronic
1199828634 X:151525967-151525989 CTCAGGAGGCTGAGGGAGAATGG + Intergenic
1201730254 Y:17194220-17194242 CTCAGAATTCAGAGGGAGCAAGG + Intergenic
1201935515 Y:19407136-19407158 CCATGGAGCCAGTGGGAGCTGGG - Intergenic
1202037338 Y:20648201-20648223 GTCAGGTGCCTGAGGGAGCAGGG - Intergenic