ID: 1049577805

View in Genome Browser
Species Human (GRCh38)
Location 8:143397760-143397782
Sequence CTCCCCAAGGGGCTCTGGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049577793_1049577805 9 Left 1049577793 8:143397728-143397750 CCTGTGCCCACCACCTTCGCTCA No data
Right 1049577805 8:143397760-143397782 CTCCCCAAGGGGCTCTGGCGAGG No data
1049577796_1049577805 2 Left 1049577796 8:143397735-143397757 CCACCACCTTCGCTCAGCATGGG No data
Right 1049577805 8:143397760-143397782 CTCCCCAAGGGGCTCTGGCGAGG No data
1049577799_1049577805 -1 Left 1049577799 8:143397738-143397760 CCACCTTCGCTCAGCATGGGGTC No data
Right 1049577805 8:143397760-143397782 CTCCCCAAGGGGCTCTGGCGAGG No data
1049577800_1049577805 -4 Left 1049577800 8:143397741-143397763 CCTTCGCTCAGCATGGGGTCTCC No data
Right 1049577805 8:143397760-143397782 CTCCCCAAGGGGCTCTGGCGAGG No data
1049577794_1049577805 3 Left 1049577794 8:143397734-143397756 CCCACCACCTTCGCTCAGCATGG No data
Right 1049577805 8:143397760-143397782 CTCCCCAAGGGGCTCTGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049577805 Original CRISPR CTCCCCAAGGGGCTCTGGCG AGG Intergenic
No off target data available for this crispr