ID: 1049578338

View in Genome Browser
Species Human (GRCh38)
Location 8:143399873-143399895
Sequence GGGAGGGTGAAGGCTGCACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049578338_1049578346 -3 Left 1049578338 8:143399873-143399895 CCGCGTGCAGCCTTCACCCTCCC No data
Right 1049578346 8:143399893-143399915 CCCCTGCCAGCCGGGGCAGTCGG No data
1049578338_1049578342 -10 Left 1049578338 8:143399873-143399895 CCGCGTGCAGCCTTCACCCTCCC No data
Right 1049578342 8:143399886-143399908 TCACCCTCCCCTGCCAGCCGGGG No data
1049578338_1049578353 29 Left 1049578338 8:143399873-143399895 CCGCGTGCAGCCTTCACCCTCCC No data
Right 1049578353 8:143399925-143399947 ATACGCAGACCGCTGACCTTGGG No data
1049578338_1049578352 28 Left 1049578338 8:143399873-143399895 CCGCGTGCAGCCTTCACCCTCCC No data
Right 1049578352 8:143399924-143399946 AATACGCAGACCGCTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049578338 Original CRISPR GGGAGGGTGAAGGCTGCACG CGG (reversed) Intergenic