ID: 1049578339 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:143399883-143399905 |
Sequence | CGGCTGGCAGGGGAGGGTGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1049578339_1049578353 | 19 | Left | 1049578339 | 8:143399883-143399905 | CCTTCACCCTCCCCTGCCAGCCG | No data | ||
Right | 1049578353 | 8:143399925-143399947 | ATACGCAGACCGCTGACCTTGGG | No data | ||||
1049578339_1049578352 | 18 | Left | 1049578339 | 8:143399883-143399905 | CCTTCACCCTCCCCTGCCAGCCG | No data | ||
Right | 1049578352 | 8:143399924-143399946 | AATACGCAGACCGCTGACCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1049578339 | Original CRISPR | CGGCTGGCAGGGGAGGGTGA AGG (reversed) | Intergenic | ||