ID: 1049578339

View in Genome Browser
Species Human (GRCh38)
Location 8:143399883-143399905
Sequence CGGCTGGCAGGGGAGGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049578339_1049578353 19 Left 1049578339 8:143399883-143399905 CCTTCACCCTCCCCTGCCAGCCG No data
Right 1049578353 8:143399925-143399947 ATACGCAGACCGCTGACCTTGGG No data
1049578339_1049578352 18 Left 1049578339 8:143399883-143399905 CCTTCACCCTCCCCTGCCAGCCG No data
Right 1049578352 8:143399924-143399946 AATACGCAGACCGCTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049578339 Original CRISPR CGGCTGGCAGGGGAGGGTGA AGG (reversed) Intergenic