ID: 1049578343

View in Genome Browser
Species Human (GRCh38)
Location 8:143399889-143399911
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049578343_1049578355 28 Left 1049578343 8:143399889-143399911 CCCTCCCCTGCCAGCCGGGGCAG No data
Right 1049578355 8:143399940-143399962 ACCTTGGGCCTGCAGTCTGCTGG No data
1049578343_1049578352 12 Left 1049578343 8:143399889-143399911 CCCTCCCCTGCCAGCCGGGGCAG No data
Right 1049578352 8:143399924-143399946 AATACGCAGACCGCTGACCTTGG No data
1049578343_1049578358 30 Left 1049578343 8:143399889-143399911 CCCTCCCCTGCCAGCCGGGGCAG No data
Right 1049578358 8:143399942-143399964 CTTGGGCCTGCAGTCTGCTGGGG No data
1049578343_1049578353 13 Left 1049578343 8:143399889-143399911 CCCTCCCCTGCCAGCCGGGGCAG No data
Right 1049578353 8:143399925-143399947 ATACGCAGACCGCTGACCTTGGG No data
1049578343_1049578357 29 Left 1049578343 8:143399889-143399911 CCCTCCCCTGCCAGCCGGGGCAG No data
Right 1049578357 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049578343 Original CRISPR CTGCCCCGGCTGGCAGGGGA GGG (reversed) Intergenic