ID: 1049578345

View in Genome Browser
Species Human (GRCh38)
Location 8:143399893-143399915
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049578345_1049578355 24 Left 1049578345 8:143399893-143399915 CCCCTGCCAGCCGGGGCAGTCGG No data
Right 1049578355 8:143399940-143399962 ACCTTGGGCCTGCAGTCTGCTGG No data
1049578345_1049578358 26 Left 1049578345 8:143399893-143399915 CCCCTGCCAGCCGGGGCAGTCGG No data
Right 1049578358 8:143399942-143399964 CTTGGGCCTGCAGTCTGCTGGGG No data
1049578345_1049578353 9 Left 1049578345 8:143399893-143399915 CCCCTGCCAGCCGGGGCAGTCGG No data
Right 1049578353 8:143399925-143399947 ATACGCAGACCGCTGACCTTGGG No data
1049578345_1049578359 27 Left 1049578345 8:143399893-143399915 CCCCTGCCAGCCGGGGCAGTCGG No data
Right 1049578359 8:143399943-143399965 TTGGGCCTGCAGTCTGCTGGGGG No data
1049578345_1049578357 25 Left 1049578345 8:143399893-143399915 CCCCTGCCAGCCGGGGCAGTCGG No data
Right 1049578357 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
1049578345_1049578352 8 Left 1049578345 8:143399893-143399915 CCCCTGCCAGCCGGGGCAGTCGG No data
Right 1049578352 8:143399924-143399946 AATACGCAGACCGCTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049578345 Original CRISPR CCGACTGCCCCGGCTGGCAG GGG (reversed) Intergenic