ID: 1049578347

View in Genome Browser
Species Human (GRCh38)
Location 8:143399894-143399916
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049578347_1049578359 26 Left 1049578347 8:143399894-143399916 CCCTGCCAGCCGGGGCAGTCGGC No data
Right 1049578359 8:143399943-143399965 TTGGGCCTGCAGTCTGCTGGGGG No data
1049578347_1049578360 30 Left 1049578347 8:143399894-143399916 CCCTGCCAGCCGGGGCAGTCGGC No data
Right 1049578360 8:143399947-143399969 GCCTGCAGTCTGCTGGGGGCTGG No data
1049578347_1049578353 8 Left 1049578347 8:143399894-143399916 CCCTGCCAGCCGGGGCAGTCGGC No data
Right 1049578353 8:143399925-143399947 ATACGCAGACCGCTGACCTTGGG No data
1049578347_1049578355 23 Left 1049578347 8:143399894-143399916 CCCTGCCAGCCGGGGCAGTCGGC No data
Right 1049578355 8:143399940-143399962 ACCTTGGGCCTGCAGTCTGCTGG No data
1049578347_1049578357 24 Left 1049578347 8:143399894-143399916 CCCTGCCAGCCGGGGCAGTCGGC No data
Right 1049578357 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
1049578347_1049578358 25 Left 1049578347 8:143399894-143399916 CCCTGCCAGCCGGGGCAGTCGGC No data
Right 1049578358 8:143399942-143399964 CTTGGGCCTGCAGTCTGCTGGGG No data
1049578347_1049578352 7 Left 1049578347 8:143399894-143399916 CCCTGCCAGCCGGGGCAGTCGGC No data
Right 1049578352 8:143399924-143399946 AATACGCAGACCGCTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049578347 Original CRISPR GCCGACTGCCCCGGCTGGCA GGG (reversed) Intergenic