ID: 1049578350

View in Genome Browser
Species Human (GRCh38)
Location 8:143399903-143399925
Sequence TTGACAGCGGCCGACTGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049578350_1049578355 14 Left 1049578350 8:143399903-143399925 CCGGGGCAGTCGGCCGCTGTCAA No data
Right 1049578355 8:143399940-143399962 ACCTTGGGCCTGCAGTCTGCTGG No data
1049578350_1049578362 22 Left 1049578350 8:143399903-143399925 CCGGGGCAGTCGGCCGCTGTCAA No data
Right 1049578362 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
1049578350_1049578357 15 Left 1049578350 8:143399903-143399925 CCGGGGCAGTCGGCCGCTGTCAA No data
Right 1049578357 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
1049578350_1049578358 16 Left 1049578350 8:143399903-143399925 CCGGGGCAGTCGGCCGCTGTCAA No data
Right 1049578358 8:143399942-143399964 CTTGGGCCTGCAGTCTGCTGGGG No data
1049578350_1049578360 21 Left 1049578350 8:143399903-143399925 CCGGGGCAGTCGGCCGCTGTCAA No data
Right 1049578360 8:143399947-143399969 GCCTGCAGTCTGCTGGGGGCTGG No data
1049578350_1049578352 -2 Left 1049578350 8:143399903-143399925 CCGGGGCAGTCGGCCGCTGTCAA No data
Right 1049578352 8:143399924-143399946 AATACGCAGACCGCTGACCTTGG No data
1049578350_1049578359 17 Left 1049578350 8:143399903-143399925 CCGGGGCAGTCGGCCGCTGTCAA No data
Right 1049578359 8:143399943-143399965 TTGGGCCTGCAGTCTGCTGGGGG No data
1049578350_1049578353 -1 Left 1049578350 8:143399903-143399925 CCGGGGCAGTCGGCCGCTGTCAA No data
Right 1049578353 8:143399925-143399947 ATACGCAGACCGCTGACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049578350 Original CRISPR TTGACAGCGGCCGACTGCCC CGG (reversed) Intergenic