ID: 1049578351

View in Genome Browser
Species Human (GRCh38)
Location 8:143399916-143399938
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049578351_1049578364 23 Left 1049578351 8:143399916-143399938 CCGCTGTCAATACGCAGACCGCT No data
Right 1049578364 8:143399962-143399984 GGGGCTGGGATCTCCCGGAGAGG No data
1049578351_1049578360 8 Left 1049578351 8:143399916-143399938 CCGCTGTCAATACGCAGACCGCT No data
Right 1049578360 8:143399947-143399969 GCCTGCAGTCTGCTGGGGGCTGG No data
1049578351_1049578355 1 Left 1049578351 8:143399916-143399938 CCGCTGTCAATACGCAGACCGCT No data
Right 1049578355 8:143399940-143399962 ACCTTGGGCCTGCAGTCTGCTGG No data
1049578351_1049578358 3 Left 1049578351 8:143399916-143399938 CCGCTGTCAATACGCAGACCGCT No data
Right 1049578358 8:143399942-143399964 CTTGGGCCTGCAGTCTGCTGGGG No data
1049578351_1049578363 18 Left 1049578351 8:143399916-143399938 CCGCTGTCAATACGCAGACCGCT No data
Right 1049578363 8:143399957-143399979 TGCTGGGGGCTGGGATCTCCCGG No data
1049578351_1049578359 4 Left 1049578351 8:143399916-143399938 CCGCTGTCAATACGCAGACCGCT No data
Right 1049578359 8:143399943-143399965 TTGGGCCTGCAGTCTGCTGGGGG No data
1049578351_1049578362 9 Left 1049578351 8:143399916-143399938 CCGCTGTCAATACGCAGACCGCT No data
Right 1049578362 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
1049578351_1049578365 30 Left 1049578351 8:143399916-143399938 CCGCTGTCAATACGCAGACCGCT No data
Right 1049578365 8:143399969-143399991 GGATCTCCCGGAGAGGCTTCTGG No data
1049578351_1049578357 2 Left 1049578351 8:143399916-143399938 CCGCTGTCAATACGCAGACCGCT No data
Right 1049578357 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049578351 Original CRISPR AGCGGTCTGCGTATTGACAG CGG (reversed) Intergenic