ID: 1049578352

View in Genome Browser
Species Human (GRCh38)
Location 8:143399924-143399946
Sequence AATACGCAGACCGCTGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049578343_1049578352 12 Left 1049578343 8:143399889-143399911 CCCTCCCCTGCCAGCCGGGGCAG No data
Right 1049578352 8:143399924-143399946 AATACGCAGACCGCTGACCTTGG No data
1049578345_1049578352 8 Left 1049578345 8:143399893-143399915 CCCCTGCCAGCCGGGGCAGTCGG No data
Right 1049578352 8:143399924-143399946 AATACGCAGACCGCTGACCTTGG No data
1049578347_1049578352 7 Left 1049578347 8:143399894-143399916 CCCTGCCAGCCGGGGCAGTCGGC No data
Right 1049578352 8:143399924-143399946 AATACGCAGACCGCTGACCTTGG No data
1049578350_1049578352 -2 Left 1049578350 8:143399903-143399925 CCGGGGCAGTCGGCCGCTGTCAA No data
Right 1049578352 8:143399924-143399946 AATACGCAGACCGCTGACCTTGG No data
1049578339_1049578352 18 Left 1049578339 8:143399883-143399905 CCTTCACCCTCCCCTGCCAGCCG No data
Right 1049578352 8:143399924-143399946 AATACGCAGACCGCTGACCTTGG No data
1049578344_1049578352 11 Left 1049578344 8:143399890-143399912 CCTCCCCTGCCAGCCGGGGCAGT No data
Right 1049578352 8:143399924-143399946 AATACGCAGACCGCTGACCTTGG No data
1049578348_1049578352 6 Left 1049578348 8:143399895-143399917 CCTGCCAGCCGGGGCAGTCGGCC No data
Right 1049578352 8:143399924-143399946 AATACGCAGACCGCTGACCTTGG No data
1049578338_1049578352 28 Left 1049578338 8:143399873-143399895 CCGCGTGCAGCCTTCACCCTCCC No data
Right 1049578352 8:143399924-143399946 AATACGCAGACCGCTGACCTTGG No data
1049578349_1049578352 2 Left 1049578349 8:143399899-143399921 CCAGCCGGGGCAGTCGGCCGCTG No data
Right 1049578352 8:143399924-143399946 AATACGCAGACCGCTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049578352 Original CRISPR AATACGCAGACCGCTGACCT TGG Intergenic