ID: 1049578354

View in Genome Browser
Species Human (GRCh38)
Location 8:143399934-143399956
Sequence GACTGCAGGCCCAAGGTCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049578354_1049578369 23 Left 1049578354 8:143399934-143399956 CCGCTGACCTTGGGCCTGCAGTC No data
Right 1049578369 8:143399980-143400002 AGAGGCTTCTGGAGCAGGAAAGG No data
1049578354_1049578364 5 Left 1049578354 8:143399934-143399956 CCGCTGACCTTGGGCCTGCAGTC No data
Right 1049578364 8:143399962-143399984 GGGGCTGGGATCTCCCGGAGAGG No data
1049578354_1049578371 25 Left 1049578354 8:143399934-143399956 CCGCTGACCTTGGGCCTGCAGTC No data
Right 1049578371 8:143399982-143400004 AGGCTTCTGGAGCAGGAAAGGGG No data
1049578354_1049578372 28 Left 1049578354 8:143399934-143399956 CCGCTGACCTTGGGCCTGCAGTC No data
Right 1049578372 8:143399985-143400007 CTTCTGGAGCAGGAAAGGGGTGG No data
1049578354_1049578365 12 Left 1049578354 8:143399934-143399956 CCGCTGACCTTGGGCCTGCAGTC No data
Right 1049578365 8:143399969-143399991 GGATCTCCCGGAGAGGCTTCTGG No data
1049578354_1049578367 18 Left 1049578354 8:143399934-143399956 CCGCTGACCTTGGGCCTGCAGTC No data
Right 1049578367 8:143399975-143399997 CCCGGAGAGGCTTCTGGAGCAGG No data
1049578354_1049578363 0 Left 1049578354 8:143399934-143399956 CCGCTGACCTTGGGCCTGCAGTC No data
Right 1049578363 8:143399957-143399979 TGCTGGGGGCTGGGATCTCCCGG No data
1049578354_1049578373 29 Left 1049578354 8:143399934-143399956 CCGCTGACCTTGGGCCTGCAGTC No data
Right 1049578373 8:143399986-143400008 TTCTGGAGCAGGAAAGGGGTGGG No data
1049578354_1049578362 -9 Left 1049578354 8:143399934-143399956 CCGCTGACCTTGGGCCTGCAGTC No data
Right 1049578362 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
1049578354_1049578360 -10 Left 1049578354 8:143399934-143399956 CCGCTGACCTTGGGCCTGCAGTC No data
Right 1049578360 8:143399947-143399969 GCCTGCAGTCTGCTGGGGGCTGG No data
1049578354_1049578370 24 Left 1049578354 8:143399934-143399956 CCGCTGACCTTGGGCCTGCAGTC No data
Right 1049578370 8:143399981-143400003 GAGGCTTCTGGAGCAGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049578354 Original CRISPR GACTGCAGGCCCAAGGTCAG CGG (reversed) Intergenic