ID: 1049578356

View in Genome Browser
Species Human (GRCh38)
Location 8:143399941-143399963
Sequence CCCAGCAGACTGCAGGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049578356_1049578369 16 Left 1049578356 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
Right 1049578369 8:143399980-143400002 AGAGGCTTCTGGAGCAGGAAAGG No data
1049578356_1049578374 28 Left 1049578356 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
Right 1049578374 8:143399992-143400014 AGCAGGAAAGGGGTGGGCAGTGG No data
1049578356_1049578364 -2 Left 1049578356 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
Right 1049578364 8:143399962-143399984 GGGGCTGGGATCTCCCGGAGAGG No data
1049578356_1049578365 5 Left 1049578356 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
Right 1049578365 8:143399969-143399991 GGATCTCCCGGAGAGGCTTCTGG No data
1049578356_1049578363 -7 Left 1049578356 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
Right 1049578363 8:143399957-143399979 TGCTGGGGGCTGGGATCTCCCGG No data
1049578356_1049578367 11 Left 1049578356 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
Right 1049578367 8:143399975-143399997 CCCGGAGAGGCTTCTGGAGCAGG No data
1049578356_1049578373 22 Left 1049578356 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
Right 1049578373 8:143399986-143400008 TTCTGGAGCAGGAAAGGGGTGGG No data
1049578356_1049578376 30 Left 1049578356 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
Right 1049578376 8:143399994-143400016 CAGGAAAGGGGTGGGCAGTGGGG No data
1049578356_1049578372 21 Left 1049578356 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
Right 1049578372 8:143399985-143400007 CTTCTGGAGCAGGAAAGGGGTGG No data
1049578356_1049578371 18 Left 1049578356 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
Right 1049578371 8:143399982-143400004 AGGCTTCTGGAGCAGGAAAGGGG No data
1049578356_1049578370 17 Left 1049578356 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
Right 1049578370 8:143399981-143400003 GAGGCTTCTGGAGCAGGAAAGGG No data
1049578356_1049578375 29 Left 1049578356 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
Right 1049578375 8:143399993-143400015 GCAGGAAAGGGGTGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049578356 Original CRISPR CCCAGCAGACTGCAGGCCCA AGG (reversed) Intergenic