ID: 1049578357

View in Genome Browser
Species Human (GRCh38)
Location 8:143399941-143399963
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049578351_1049578357 2 Left 1049578351 8:143399916-143399938 CCGCTGTCAATACGCAGACCGCT No data
Right 1049578357 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
1049578349_1049578357 19 Left 1049578349 8:143399899-143399921 CCAGCCGGGGCAGTCGGCCGCTG No data
Right 1049578357 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
1049578347_1049578357 24 Left 1049578347 8:143399894-143399916 CCCTGCCAGCCGGGGCAGTCGGC No data
Right 1049578357 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
1049578344_1049578357 28 Left 1049578344 8:143399890-143399912 CCTCCCCTGCCAGCCGGGGCAGT No data
Right 1049578357 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
1049578348_1049578357 23 Left 1049578348 8:143399895-143399917 CCTGCCAGCCGGGGCAGTCGGCC No data
Right 1049578357 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
1049578343_1049578357 29 Left 1049578343 8:143399889-143399911 CCCTCCCCTGCCAGCCGGGGCAG No data
Right 1049578357 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
1049578350_1049578357 15 Left 1049578350 8:143399903-143399925 CCGGGGCAGTCGGCCGCTGTCAA No data
Right 1049578357 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
1049578345_1049578357 25 Left 1049578345 8:143399893-143399915 CCCCTGCCAGCCGGGGCAGTCGG No data
Right 1049578357 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049578357 Original CRISPR CCTTGGGCCTGCAGTCTGCT GGG Intergenic