ID: 1049578361

View in Genome Browser
Species Human (GRCh38)
Location 8:143399948-143399970
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049578361_1049578370 10 Left 1049578361 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
Right 1049578370 8:143399981-143400003 GAGGCTTCTGGAGCAGGAAAGGG No data
1049578361_1049578374 21 Left 1049578361 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
Right 1049578374 8:143399992-143400014 AGCAGGAAAGGGGTGGGCAGTGG No data
1049578361_1049578371 11 Left 1049578361 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
Right 1049578371 8:143399982-143400004 AGGCTTCTGGAGCAGGAAAGGGG No data
1049578361_1049578372 14 Left 1049578361 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
Right 1049578372 8:143399985-143400007 CTTCTGGAGCAGGAAAGGGGTGG No data
1049578361_1049578376 23 Left 1049578361 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
Right 1049578376 8:143399994-143400016 CAGGAAAGGGGTGGGCAGTGGGG No data
1049578361_1049578375 22 Left 1049578361 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
Right 1049578375 8:143399993-143400015 GCAGGAAAGGGGTGGGCAGTGGG No data
1049578361_1049578364 -9 Left 1049578361 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
Right 1049578364 8:143399962-143399984 GGGGCTGGGATCTCCCGGAGAGG No data
1049578361_1049578369 9 Left 1049578361 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
Right 1049578369 8:143399980-143400002 AGAGGCTTCTGGAGCAGGAAAGG No data
1049578361_1049578367 4 Left 1049578361 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
Right 1049578367 8:143399975-143399997 CCCGGAGAGGCTTCTGGAGCAGG No data
1049578361_1049578365 -2 Left 1049578361 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
Right 1049578365 8:143399969-143399991 GGATCTCCCGGAGAGGCTTCTGG No data
1049578361_1049578373 15 Left 1049578361 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
Right 1049578373 8:143399986-143400008 TTCTGGAGCAGGAAAGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049578361 Original CRISPR CCCAGCCCCCAGCAGACTGC AGG (reversed) Intergenic