ID: 1049578362

View in Genome Browser
Species Human (GRCh38)
Location 8:143399948-143399970
Sequence CCTGCAGTCTGCTGGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049578349_1049578362 26 Left 1049578349 8:143399899-143399921 CCAGCCGGGGCAGTCGGCCGCTG No data
Right 1049578362 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
1049578351_1049578362 9 Left 1049578351 8:143399916-143399938 CCGCTGTCAATACGCAGACCGCT No data
Right 1049578362 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
1049578348_1049578362 30 Left 1049578348 8:143399895-143399917 CCTGCCAGCCGGGGCAGTCGGCC No data
Right 1049578362 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
1049578350_1049578362 22 Left 1049578350 8:143399903-143399925 CCGGGGCAGTCGGCCGCTGTCAA No data
Right 1049578362 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
1049578354_1049578362 -9 Left 1049578354 8:143399934-143399956 CCGCTGACCTTGGGCCTGCAGTC No data
Right 1049578362 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049578362 Original CRISPR CCTGCAGTCTGCTGGGGGCT GGG Intergenic
No off target data available for this crispr