ID: 1049578363

View in Genome Browser
Species Human (GRCh38)
Location 8:143399957-143399979
Sequence TGCTGGGGGCTGGGATCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049578356_1049578363 -7 Left 1049578356 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
Right 1049578363 8:143399957-143399979 TGCTGGGGGCTGGGATCTCCCGG No data
1049578351_1049578363 18 Left 1049578351 8:143399916-143399938 CCGCTGTCAATACGCAGACCGCT No data
Right 1049578363 8:143399957-143399979 TGCTGGGGGCTGGGATCTCCCGG No data
1049578354_1049578363 0 Left 1049578354 8:143399934-143399956 CCGCTGACCTTGGGCCTGCAGTC No data
Right 1049578363 8:143399957-143399979 TGCTGGGGGCTGGGATCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049578363 Original CRISPR TGCTGGGGGCTGGGATCTCC CGG Intergenic
No off target data available for this crispr