ID: 1049578364

View in Genome Browser
Species Human (GRCh38)
Location 8:143399962-143399984
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049578351_1049578364 23 Left 1049578351 8:143399916-143399938 CCGCTGTCAATACGCAGACCGCT No data
Right 1049578364 8:143399962-143399984 GGGGCTGGGATCTCCCGGAGAGG No data
1049578356_1049578364 -2 Left 1049578356 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
Right 1049578364 8:143399962-143399984 GGGGCTGGGATCTCCCGGAGAGG No data
1049578361_1049578364 -9 Left 1049578361 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
Right 1049578364 8:143399962-143399984 GGGGCTGGGATCTCCCGGAGAGG No data
1049578354_1049578364 5 Left 1049578354 8:143399934-143399956 CCGCTGACCTTGGGCCTGCAGTC No data
Right 1049578364 8:143399962-143399984 GGGGCTGGGATCTCCCGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049578364 Original CRISPR GGGGCTGGGATCTCCCGGAG AGG Intergenic