ID: 1049578367

View in Genome Browser
Species Human (GRCh38)
Location 8:143399975-143399997
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049578356_1049578367 11 Left 1049578356 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
Right 1049578367 8:143399975-143399997 CCCGGAGAGGCTTCTGGAGCAGG No data
1049578354_1049578367 18 Left 1049578354 8:143399934-143399956 CCGCTGACCTTGGGCCTGCAGTC No data
Right 1049578367 8:143399975-143399997 CCCGGAGAGGCTTCTGGAGCAGG No data
1049578361_1049578367 4 Left 1049578361 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
Right 1049578367 8:143399975-143399997 CCCGGAGAGGCTTCTGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049578367 Original CRISPR CCCGGAGAGGCTTCTGGAGC AGG Intergenic