ID: 1049578374

View in Genome Browser
Species Human (GRCh38)
Location 8:143399992-143400014
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049578368_1049578374 -7 Left 1049578368 8:143399976-143399998 CCGGAGAGGCTTCTGGAGCAGGA No data
Right 1049578374 8:143399992-143400014 AGCAGGAAAGGGGTGGGCAGTGG No data
1049578366_1049578374 -6 Left 1049578366 8:143399975-143399997 CCCGGAGAGGCTTCTGGAGCAGG No data
Right 1049578374 8:143399992-143400014 AGCAGGAAAGGGGTGGGCAGTGG No data
1049578361_1049578374 21 Left 1049578361 8:143399948-143399970 CCTGCAGTCTGCTGGGGGCTGGG No data
Right 1049578374 8:143399992-143400014 AGCAGGAAAGGGGTGGGCAGTGG No data
1049578356_1049578374 28 Left 1049578356 8:143399941-143399963 CCTTGGGCCTGCAGTCTGCTGGG No data
Right 1049578374 8:143399992-143400014 AGCAGGAAAGGGGTGGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049578374 Original CRISPR AGCAGGAAAGGGGTGGGCAG TGG Intergenic