ID: 1049581656

View in Genome Browser
Species Human (GRCh38)
Location 8:143414344-143414366
Sequence CTTTTTTTTTTAAGGATAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049581649_1049581656 29 Left 1049581649 8:143414292-143414314 CCCCAAAAAACTTCCAGAGGGGG No data
Right 1049581656 8:143414344-143414366 CTTTTTTTTTTAAGGATAAAGGG No data
1049581653_1049581656 16 Left 1049581653 8:143414305-143414327 CCAGAGGGGGAAAAAATAGTCAC No data
Right 1049581656 8:143414344-143414366 CTTTTTTTTTTAAGGATAAAGGG No data
1049581651_1049581656 28 Left 1049581651 8:143414293-143414315 CCCAAAAAACTTCCAGAGGGGGA No data
Right 1049581656 8:143414344-143414366 CTTTTTTTTTTAAGGATAAAGGG No data
1049581652_1049581656 27 Left 1049581652 8:143414294-143414316 CCAAAAAACTTCCAGAGGGGGAA No data
Right 1049581656 8:143414344-143414366 CTTTTTTTTTTAAGGATAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049581656 Original CRISPR CTTTTTTTTTTAAGGATAAA GGG Intergenic
No off target data available for this crispr