ID: 1049582686

View in Genome Browser
Species Human (GRCh38)
Location 8:143420056-143420078
Sequence GAGCCAAGCTCTGTTCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049582677_1049582686 1 Left 1049582677 8:143420032-143420054 CCTTCCCTGCTCCCCTCCTGCCA 0: 1
1: 2
2: 18
3: 256
4: 2807
Right 1049582686 8:143420056-143420078 GAGCCAAGCTCTGTTCCCCCAGG No data
1049582672_1049582686 17 Left 1049582672 8:143420016-143420038 CCCTCCCATGCCTGCTCCTTCCC 0: 1
1: 1
2: 12
3: 117
4: 1412
Right 1049582686 8:143420056-143420078 GAGCCAAGCTCTGTTCCCCCAGG No data
1049582671_1049582686 18 Left 1049582671 8:143420015-143420037 CCCCTCCCATGCCTGCTCCTTCC 0: 1
1: 0
2: 13
3: 126
4: 1211
Right 1049582686 8:143420056-143420078 GAGCCAAGCTCTGTTCCCCCAGG No data
1049582680_1049582686 -4 Left 1049582680 8:143420037-143420059 CCTGCTCCCCTCCTGCCAGGAGC 0: 1
1: 0
2: 6
3: 68
4: 671
Right 1049582686 8:143420056-143420078 GAGCCAAGCTCTGTTCCCCCAGG No data
1049582673_1049582686 16 Left 1049582673 8:143420017-143420039 CCTCCCATGCCTGCTCCTTCCCT 0: 1
1: 0
2: 7
3: 143
4: 1328
Right 1049582686 8:143420056-143420078 GAGCCAAGCTCTGTTCCCCCAGG No data
1049582679_1049582686 -3 Left 1049582679 8:143420036-143420058 CCCTGCTCCCCTCCTGCCAGGAG 0: 1
1: 1
2: 6
3: 73
4: 502
Right 1049582686 8:143420056-143420078 GAGCCAAGCTCTGTTCCCCCAGG No data
1049582674_1049582686 13 Left 1049582674 8:143420020-143420042 CCCATGCCTGCTCCTTCCCTGCT 0: 1
1: 0
2: 9
3: 89
4: 738
Right 1049582686 8:143420056-143420078 GAGCCAAGCTCTGTTCCCCCAGG No data
1049582681_1049582686 -10 Left 1049582681 8:143420043-143420065 CCCCTCCTGCCAGGAGCCAAGCT 0: 1
1: 0
2: 2
3: 32
4: 346
Right 1049582686 8:143420056-143420078 GAGCCAAGCTCTGTTCCCCCAGG No data
1049582676_1049582686 7 Left 1049582676 8:143420026-143420048 CCTGCTCCTTCCCTGCTCCCCTC 0: 1
1: 0
2: 21
3: 257
4: 2139
Right 1049582686 8:143420056-143420078 GAGCCAAGCTCTGTTCCCCCAGG No data
1049582675_1049582686 12 Left 1049582675 8:143420021-143420043 CCATGCCTGCTCCTTCCCTGCTC 0: 1
1: 0
2: 15
3: 148
4: 1232
Right 1049582686 8:143420056-143420078 GAGCCAAGCTCTGTTCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049582686 Original CRISPR GAGCCAAGCTCTGTTCCCCC AGG Intronic
No off target data available for this crispr