ID: 1049583241

View in Genome Browser
Species Human (GRCh38)
Location 8:143422040-143422062
Sequence GACGGGAGCAAGGGTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049583233_1049583241 -5 Left 1049583233 8:143422022-143422044 CCTGGGTCCCAGCCAGGAGACGG 0: 1
1: 0
2: 1
3: 37
4: 311
Right 1049583241 8:143422040-143422062 GACGGGAGCAAGGGTGCTGCAGG No data
1049583231_1049583241 2 Left 1049583231 8:143422015-143422037 CCAGACACCTGGGTCCCAGCCAG 0: 1
1: 0
2: 2
3: 45
4: 357
Right 1049583241 8:143422040-143422062 GACGGGAGCAAGGGTGCTGCAGG No data
1049583226_1049583241 20 Left 1049583226 8:143421997-143422019 CCCCTCTGGGGGAGGTGACCAGA 0: 1
1: 0
2: 3
3: 19
4: 217
Right 1049583241 8:143422040-143422062 GACGGGAGCAAGGGTGCTGCAGG No data
1049583227_1049583241 19 Left 1049583227 8:143421998-143422020 CCCTCTGGGGGAGGTGACCAGAC 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1049583241 8:143422040-143422062 GACGGGAGCAAGGGTGCTGCAGG No data
1049583224_1049583241 24 Left 1049583224 8:143421993-143422015 CCCACCCCTCTGGGGGAGGTGAC 0: 1
1: 0
2: 1
3: 13
4: 122
Right 1049583241 8:143422040-143422062 GACGGGAGCAAGGGTGCTGCAGG No data
1049583228_1049583241 18 Left 1049583228 8:143421999-143422021 CCTCTGGGGGAGGTGACCAGACA 0: 1
1: 0
2: 1
3: 19
4: 238
Right 1049583241 8:143422040-143422062 GACGGGAGCAAGGGTGCTGCAGG No data
1049583225_1049583241 23 Left 1049583225 8:143421994-143422016 CCACCCCTCTGGGGGAGGTGACC 0: 1
1: 0
2: 1
3: 20
4: 174
Right 1049583241 8:143422040-143422062 GACGGGAGCAAGGGTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049583241 Original CRISPR GACGGGAGCAAGGGTGCTGC AGG Intronic
No off target data available for this crispr