ID: 1049583942

View in Genome Browser
Species Human (GRCh38)
Location 8:143424436-143424458
Sequence GGTCCTTGGAGCCACCGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 100}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049583942_1049583955 20 Left 1049583942 8:143424436-143424458 CCCTCACGGTGGCTCCAAGGACC 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1049583955 8:143424479-143424501 AAGGAGAGGCCAAGGCAGCCAGG No data
1049583942_1049583949 -7 Left 1049583942 8:143424436-143424458 CCCTCACGGTGGCTCCAAGGACC 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1049583949 8:143424452-143424474 AAGGACCAGGGCTGGGAGAGAGG No data
1049583942_1049583954 12 Left 1049583942 8:143424436-143424458 CCCTCACGGTGGCTCCAAGGACC 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1049583954 8:143424471-143424493 GAGGTGGCAAGGAGAGGCCAAGG No data
1049583942_1049583960 30 Left 1049583942 8:143424436-143424458 CCCTCACGGTGGCTCCAAGGACC 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1049583960 8:143424489-143424511 CAAGGCAGCCAGGGCAGGGCAGG No data
1049583942_1049583953 6 Left 1049583942 8:143424436-143424458 CCCTCACGGTGGCTCCAAGGACC 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1049583953 8:143424465-143424487 GGGAGAGAGGTGGCAAGGAGAGG No data
1049583942_1049583957 25 Left 1049583942 8:143424436-143424458 CCCTCACGGTGGCTCCAAGGACC 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1049583957 8:143424484-143424506 GAGGCCAAGGCAGCCAGGGCAGG No data
1049583942_1049583952 1 Left 1049583942 8:143424436-143424458 CCCTCACGGTGGCTCCAAGGACC 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1049583952 8:143424460-143424482 GGGCTGGGAGAGAGGTGGCAAGG No data
1049583942_1049583950 -4 Left 1049583942 8:143424436-143424458 CCCTCACGGTGGCTCCAAGGACC 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1049583950 8:143424455-143424477 GACCAGGGCTGGGAGAGAGGTGG No data
1049583942_1049583956 21 Left 1049583942 8:143424436-143424458 CCCTCACGGTGGCTCCAAGGACC 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1049583956 8:143424480-143424502 AGGAGAGGCCAAGGCAGCCAGGG No data
1049583942_1049583958 26 Left 1049583942 8:143424436-143424458 CCCTCACGGTGGCTCCAAGGACC 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1049583958 8:143424485-143424507 AGGCCAAGGCAGCCAGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049583942 Original CRISPR GGTCCTTGGAGCCACCGTGA GGG (reversed) Intronic
901425988 1:9182658-9182680 GGGCCTTGGTCCCACCGCGAAGG - Intergenic
901665235 1:10822533-10822555 GGCCCTTGGAGCCACCATCAGGG + Intergenic
903171908 1:21559412-21559434 AGTCCTTAGAGCGACCCTGAGGG + Intronic
904000580 1:27336295-27336317 GGGCCTTGGTGACAACGTGAAGG - Exonic
904203903 1:28840067-28840089 GGTCCTGGGAGACAGCATGAAGG + Intronic
905340985 1:37277381-37277403 GGTCCTTGGAGGCTCAGTGATGG + Intergenic
907766784 1:57421048-57421070 GATGCTTGGAGCCACCCTGCAGG - Intronic
919072835 1:192777535-192777557 AGTCCTTGGAGATACAGTGAAGG + Intergenic
920712889 1:208311817-208311839 GGTCTCTGGAGCCATGGTGAGGG + Intergenic
923255147 1:232215523-232215545 AGTTCTAGGAGCCACCCTGATGG - Intergenic
923265781 1:232312763-232312785 GGGCCTTGTAGACACGGTGAAGG + Intergenic
1069043696 10:63721043-63721065 GATCCTTGGGGCCATCTTGAAGG + Intergenic
1071601678 10:86961581-86961603 AGCCCTTGGAGCCACCTCGAGGG + Intronic
1075885389 10:125895917-125895939 GGTCCCTCGAGCCCCCCTGACGG - Intronic
1076707843 10:132311475-132311497 GGGCCTTGGAGCCCACGTGTGGG + Intronic
1084784964 11:71437016-71437038 GGTCCTTGGAGCCCCCCGCATGG - Intronic
1088969381 11:114759232-114759254 GGTCCTCGGAGCCTCCTTTAGGG + Intergenic
1089737109 11:120557107-120557129 TGTCCTTGGAGCCTGCTTGATGG + Intronic
1093019185 12:14187416-14187438 GGTCCCTGTAGCTATCGTGATGG - Intergenic
1096692220 12:53328271-53328293 GCTCCTTGGGGCCACTGGGAGGG + Exonic
1099157740 12:79200420-79200442 GGTACTTAGAGCCACTATGAGGG + Intronic
1103329625 12:120145019-120145041 GGCCCTTGGGGCCATGGTGAAGG - Exonic
1103613716 12:122139282-122139304 GGTCCTCGAAGCCACAGGGAGGG + Intronic
1104597848 12:130132131-130132153 GGGGCTTGGAGACACGGTGATGG - Intergenic
1104929513 12:132330155-132330177 GGGCCCTGGAGCCACCAGGAGGG + Intergenic
1111555491 13:89875950-89875972 TGTCCTTTGAGCCAGTGTGAGGG + Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1118174226 14:63422153-63422175 GGTCCTTGGAGCCAAGCTGAGGG + Intronic
1122364574 14:101187055-101187077 GGCCCTGGGAGCCAACGTGGGGG - Intergenic
1122764331 14:104055053-104055075 GGTTCTTGGAGGCACCATGGTGG + Intergenic
1202872663 14_GL000225v1_random:178000-178022 GGTCCCTGGAGCCCCCCTGACGG + Intergenic
1126438890 15:48665612-48665634 GGTTATTGGAGCCACTGTTATGG - Intergenic
1131874468 15:96790081-96790103 GGTCTCTGGTGCCACAGTGAAGG + Intergenic
1133110591 16:3545838-3545860 GGTCCCAGAAGCCACCCTGAGGG + Intronic
1136235046 16:28908565-28908587 AGAGCCTGGAGCCACCGTGAGGG - Intronic
1136617907 16:31410067-31410089 GGTCCTAGGTACCACCGTAAGGG + Intronic
1138659089 16:58507369-58507391 GCTCCTTGGAGCCCCCTTTAGGG + Intronic
1139526704 16:67521245-67521267 GGTCTTTGGCGCCACCGTCTGGG - Intronic
1139589992 16:67928229-67928251 GCTCCCTGGAGGCACCATGAAGG - Exonic
1145295877 17:21592577-21592599 GGGCCTTGGCGCCTCCGTCAGGG - Intergenic
1146519564 17:33515700-33515722 GGTCCTAGGAGCCACGGGCAGGG - Intronic
1152559491 17:81070838-81070860 GGTCCTTGATCCCAGCGTGATGG + Intronic
1154052526 18:10974547-10974569 AGTCCTAGGAGCCACAGTGGAGG + Intronic
1155012724 18:21796820-21796842 GGACCTAGGAGCCAACTTGAAGG + Intronic
1157804617 18:50648919-50648941 GGTCCTTGGAGCCTGGATGAGGG + Intronic
1160011005 18:75107071-75107093 GGTGCTTGGAGCCCACGTGGTGG + Intergenic
1160579506 18:79875596-79875618 GGTCTGTGGTGCCACCGTGTAGG - Intronic
1160789690 19:917777-917799 GGCCCTCGGAGCCCCCGGGACGG - Intronic
1161681967 19:5684661-5684683 GGTTCATGGAGCCACCGTGGTGG + Intronic
1165365824 19:35363983-35364005 GGTCCATGGGGCCACCGTCCTGG - Intergenic
1167887726 19:52515970-52515992 GGGCTGTGGAGCCACAGTGAGGG - Intergenic
1167910914 19:52700955-52700977 GGGCTGTGGAGCCACAGTGAGGG + Intergenic
1167918571 19:52762225-52762247 GGGCTGTGGAGCCACAGTGAGGG + Intergenic
925449175 2:3953607-3953629 GGCCTTTGGAGTCACAGTGATGG + Intergenic
930065280 2:47323230-47323252 CGACCTGGGAGCCACAGTGATGG + Intergenic
931390862 2:61842792-61842814 AGTCCTTGGAGCCACACTGCAGG - Intronic
933992551 2:87643913-87643935 TGTGCTTGGAGCCACTGTGCTGG + Intergenic
934678092 2:96264350-96264372 GGTCTTTTGAGCCATCTTGAAGG - Intronic
935617436 2:105101148-105101170 GGTCCTGGGGGCCACAGTCAAGG - Intergenic
936085710 2:109467506-109467528 GGGGCTTGGGCCCACCGTGAGGG + Intronic
936301302 2:111306928-111306950 TGTGCTTGGAGCCACTGTGCTGG - Intergenic
937275834 2:120683561-120683583 GGTACTTTGAGCCACCTAGAAGG + Intergenic
938169962 2:129066816-129066838 GGCCCTGGGAGCCTCCGTGGTGG + Intergenic
944661606 2:201926199-201926221 GGCCCTTGGACCCACAGGGAGGG + Intergenic
946309658 2:218876371-218876393 GGTCCTGGAAGCCACGGTGAGGG - Intergenic
946412889 2:219523883-219523905 GCTGCAGGGAGCCACCGTGATGG - Intronic
948333688 2:237191798-237191820 TGGCAGTGGAGCCACCGTGAGGG - Intergenic
1170611710 20:17919324-17919346 GGCTCATGGAGCCACCGTGCCGG - Intergenic
1171020900 20:21583215-21583237 GGTCCCTGGTGCCAGGGTGATGG + Intergenic
1174169490 20:48607159-48607181 CGTCCTTGCAGCCCCCGTCAGGG + Intergenic
1174277843 20:49416768-49416790 AATGTTTGGAGCCACCGTGAAGG - Intronic
1174355995 20:49998234-49998256 GATCCCTGGGGCCACTGTGATGG + Intergenic
1175719424 20:61276720-61276742 AGTTCTTAGAGCCACAGTGATGG - Intronic
1175740244 20:61414980-61415002 AATCTTTGGAGTCACCGTGAGGG - Intronic
1175999511 20:62825677-62825699 GGGCCTTGGAGGCTCTGTGAAGG - Intronic
1179607753 21:42528454-42528476 GGTCCCTGGAGCCAGGGGGATGG + Intronic
1180606623 22:17063891-17063913 GGACCAGGGAGCCATCGTGAGGG - Intergenic
1182454041 22:30438539-30438561 GGCCCTGAGAGCCACTGTGAGGG - Intergenic
950577594 3:13842090-13842112 GGGCCTGTGAGCCACCGTGAAGG + Intronic
965342830 3:167511735-167511757 GCTGATTGGAGCCACAGTGATGG - Intronic
969527928 4:7713476-7713498 GGTCCCTGTACCCACCGTGATGG - Intronic
973577819 4:52309205-52309227 CTTCCTTGGAGCCATCTTGAAGG - Intergenic
974402395 4:61424386-61424408 GGTCCAGGGTGCCACCGTGTGGG - Intronic
983739007 4:171104238-171104260 AGTGCTGGGAGCCACCGTGCTGG + Intergenic
984364331 4:178778732-178778754 CGTCCTTAGAGCCACAGTAATGG + Intergenic
986724112 5:10581399-10581421 GTTCCTAGGAGCCACGGTGTTGG - Intronic
991913877 5:71587310-71587332 GGTCCTTGCAGCCCCAGAGAAGG - Exonic
995264218 5:110139184-110139206 GCCCCTGGGAGCCACAGTGATGG + Intergenic
998190163 5:140016923-140016945 GGGCCTTGGAGGCCACGTGAGGG + Intronic
998253303 5:140566969-140566991 GGTCCTTGAAGCCACAGTCTTGG - Exonic
1003958719 6:11190110-11190132 GTCCCTGGGAGCCACCGTGTGGG + Exonic
1009380653 6:63024774-63024796 GGTCCTTTGAGATACCCTGAAGG - Intergenic
1012231776 6:96768547-96768569 GCTGATTGGAGCCACAGTGATGG - Intergenic
1013638934 6:112054328-112054350 GGACCGTGGAGCCACCCTGAGGG - Exonic
1019643554 7:2117194-2117216 GGCCCTGGGGGCCACCGTCAGGG + Intronic
1022077806 7:26990768-26990790 AGGCCTTGGAGCCACTGTCAGGG + Intronic
1022982087 7:35613263-35613285 GGGCCCTGGAGCCACCCTCAGGG + Intergenic
1028517822 7:91697823-91697845 GGTCCCTGGAAGCACCATGAAGG - Intronic
1032024926 7:128433635-128433657 GGGCCTTAGAGCCACAGTGGTGG + Intergenic
1032320825 7:130885101-130885123 CCCCCTTGGAGCCACTGTGAAGG - Intergenic
1035053708 7:156019692-156019714 GGTTGTTGGGGCCACCTTGAAGG + Intergenic
1036812925 8:11880044-11880066 GGTGCTAGGAGCCACTGGGATGG + Intergenic
1048425635 8:134320611-134320633 CGTTCCTGGAGCCTCCGTGAAGG - Intergenic
1049583942 8:143424436-143424458 GGTCCTTGGAGCCACCGTGAGGG - Intronic
1049673733 8:143880631-143880653 GCTCCATGGAGTCACCGTGCTGG + Intergenic
1049804098 8:144531128-144531150 CGTCTGTGTAGCCACCGTGAGGG + Intronic
1057481498 9:95448438-95448460 GGTCCTTGGAGCCTCCGAGGAGG + Intronic
1058912892 9:109537035-109537057 GGTCCTTGGGGCTACGGAGAGGG - Intergenic
1203731796 Un_GL000216v2:98543-98565 GGTCCCTGGAGCCCCCCTGACGG - Intergenic
1188677022 X:32954234-32954256 GGTCCTTGGAGCAATCGTATTGG - Intronic
1189247225 X:39572517-39572539 GGCCCTGGGAGCCTCAGTGAAGG + Intergenic
1196798858 X:119524217-119524239 TGTCCTTGGAGACAGCATGACGG + Intergenic
1200141927 X:153906789-153906811 GGTCCTGGGAGCCACTGGGAGGG + Exonic